Breast cancer, the most commonly diagnosed cancer in women, is the leading cause of cancer-related death (Shi et al. 2013; Yu et al. 2014; Famta et al. 2022). The application of multidisciplinary treatments that include surgery, hormonal therapy, radiation, and chemotherapy for patients with breast cancer has been reported (Prihantono and Faruk 2021). Among these, chemotherapy is still regarded as a major approach in the treatment of breast cancer (Famta et al. 2022). In particular, neoadjuvant chemotherapy, which has become the standard protocol for the management of locally advanced breast cancer, is the preferred treatment for operable breast cancer at an early stage. Anthracyclines, including adriamycin, as well as taxanes, cyclophosphamide, and platinum compounds are mainly used in the treatment of breast cancer patients (Caparica et al. 2019). In particular, adriamycin, an antibiotic belonging to the anthracycline group, is a highly sensitive alkylating chemotherapeutic drug used as a first-line adjuvant regimen in the treatment of breast cancer patients (Osman et al. 2012). Of particular interest, when the drug was administered as first-line single-agent therapy, a response was obtained in approximately 40% of patients with disseminated breast cancer (Bontenbal et al. 1998). A major issue affecting tumor patients is that repeated administration of adriamycin frequently has no effect and the tumor phenotype becomes more aggressive with high levels of P-glycoprotein (P-gp) expression. (Liu et al. 2008; Zhang et al. 2012). Despite significant advances in cancer diagnosis and treatment, chemoresistance, insensitivity of cancer cells to drug therapy, is the main cause of failure in the use of therapeutic strategies involving chemotherapy and results in disease progression (Szakács et al. 2006; Abotaleb et al. 2018).

Of the diverse mechanisms contributing to reduced drug sensitivity, increased drug efflux mediated by ATP-binding cassette superfamily proteins (ABC transporters) is a common phenomenon (Li et al. 2016). ABC transporters are ubiquitous in a variety of normal tissues including the brain, liver, intestine, placenta, kidney, and others; they are responsible for the regulation of distribution, absorption, and excretion of various xenobiotic compounds. Thus, it is thought that they are involved in protecting the body against toxic substances through their function as a detoxifier in normal cells (Fletcher et al. 2016). However, as a result of the increased expression of these transporters, the intracellular persistence of many anticancer drugs is reduced to sub-therapeutic levels, thus reducing or eliminating chemotherapeutic efficacy. P-gp, a well-known drug efflux pump belonging to the ABC transporter family, is a glycosylated transmembrane protein encoded by the ABCB1 gene. According to one study, overexpression of P-gp in cancers can be either intrinsic or acquired as a result of repeated administration of a drug, depending on the tissue of origin (Karthika et al. 2022). It can be activated by several factors, including antibiotics, analgesics, retinoic acid, sodium butyrate, UV irradiation, radiotherapy, and certain chemotherapeutic anticancer drugs (Kim 2002; Wang et al. 2012; Moitra 2015; Li et al. 2016). Overexpression of P-gp in cancer results in decreased accumulation of chemotherapeutics, leading to resistance against many currently available anti-cancer drugs including paclitaxel, vinblastine, and daunorubicin (Reed et al. 2010; Pote and Gacche 2023). Of note, a correlation of an increased level of ABC transporters with evasion of apoptosis, an increase in cell migration to provide the potential for invasion and metastasis, resulting in tumor aggressiveness has been reported (Fletcher et al. 2010; Zhang et al. 2014; Pote and Gacche 2023)

As a result of epithelial-mesenchymal transition (EMT), epithelial-derived carcinoma cells undergo a reversible process involving changes in cell-to-cell adhesion and polarity, cytoskeletal remodeling, enhanced migration and invasiveness, and dissemination to secondary organs; therefore, it is regarded as a pivotal process during cancer progression (Christofori 2006; Thiery and Sleeman 2006; Liu et al. 2013; Zheng and Kang 2014; Nieto et al. 2016). Of note, EMT has been reported to confer characteristics of drug resistance against several conventional therapeutic agents in human pancreatic cell lines, and against EGFR-targeted therapies in lung cancer (Fuchs et al. 2008; Sabbah et al. 2008; Arumugam et al. 2009; Abotaleb et al. 2018; Famta et al. 2022). Similar studies have also reported that an active EMT phenomenon in breast cancer cell lines renders them unresponsive to treatment with tamoxifen, paclitaxel, and adriamycin (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005). In addition, many studies have reported that mesenchymal tumors are more resistant to chemotherapy than epithelial tumors, and drug sensitivity is re-established upon reversal of the EMT phenotype observed in resistant cancer cell lines (Yauch et al. 2005; Carey et al. 2007; Liedtke et al. 2008; Arumugam et al. 2009; Li et al. 2009).

Despite various attempts to enhance the therapeutic effect of existing chemotherapeutic agents to overcome drug resistance in breast cancer, the effects remain unsatisfactory. The purpose of this study was to attain an understanding of the involvement of EMT in acquiring resistance to adriamycin and suggest potential therapeutic targets for reverting the mesenchymal state back to epithelial phenotype using adriamycin-resistant MCF-7 cells.

Cell lines and culture media

Human breast cancer cell lines were used in this study. MCF-7 breast cancer cell line and ADR-resistant MCF-7 (MCF-7/ADR) breast cancer cell lines were provided by Prof. Keun Wook Kang (Seoul National University, Seoul, Korea). All cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone) and 100 U/mL penicillin/streptomycin (GenDEPOT, Katy, TX, USA). MCF-7/ADR cell medium was further supplemented with ADR. All cells were maintained as monolayers in a humidified atmosphere containing 5% CO₂ at 37℃ and the culture medium was replaced every three days.

Cell viability assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA) assay was used for the determination of cell viability. MTT was prepared at 5 mg/mL in phosphate-buffered saline (PBS, pH:7.2-7.4, Biosesang, Seongnam, Korea) and stored at 4℃. For the MTT assay, the cells were seeded in 96-well cell culture plates at a density of 1 × 10⁴ cells per well. After 24 h, cells were treated with various concentrations of ADR, followed by incubation for 24 h or 48 h. The cells were incubated with 0.5 mg/mL MTT solution at 37℃ for 1 h for estimation of mitochondrial activity. Formazan crystals were dissolved in 100 µL of dimethyl sulfoxide (DMSO) and measurement of absorbance was performed at 540 nm using a MULTISKAN GO reader (Thermo Scientific, Waltham, MA, USA). The results are expressed as a percentage (%) of the results from vehicle-treated cells.

RNA extraction and RT-PCR

Total RNA was isolated using TRIzol^TM purchased from Ambion (Life Technologies, Waltham, MT, USA). cDNA was generated by reverse transcription from mRNA using the iScript^TM cDNA Synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. Further amplification of the synthesized cDNAs was performed using polymerase chain reaction (PCR) using specific primers shown in Table 1. Total cDNA was used as a template for PCR, which was amplified in a 25 μL reaction mixture containing: 1 μg of DNA, 2.5 μL of 10X PCR buffer, 2 mM MgCl2, 10 mM dNTP mixture, one unit of Taq DNA polymerase, and 1 μM of sense and anti-sense primers. The PCR program was set to a cycle of 5 min at 94°C, 30 repetitive cycles of 94°C for 30 s, 45-55°C for 30-40 s, 72°C for 1 min, as well as at 72°C for 7 min, respectively. All PCR reactions were performed in a GeneAmp PCR 2700 system (Applied Biosystems, Foster City, CA, USA), and electrophoresis was performed in 1% agarose gels using 1X TBE buffer containing 0.5 μg/mL ethidium bromide (Sigma-Aldrich) for visualization of products of PCR amplification. For calculation of the final, normalized results, the relative transcript levels of target genes were divided by the relative transcript levels of 18s.

Table 1 . Primer sequences used in PCR amplification.

Symbol	Primer sequence (5’-3’)
	Forward	Reverse
E-cadherin	TCCATTTCTTGGTCTACGCC	CACCTTCAGCCATCCTGTTT
Fibronectin	TCGAGGAGGAAATTCCAATG	CTCTTCATGACGCTTGTGGA
N-cadherin	ACAGTGGCCACCTACAAAGG	TGATCCCTCAGGAACTGTCC
Slug	GAGCATACAGCCCCATCACT	GCAGTGAGGGCAAGAAAAAG
Snail	AATGCTCATCTGGGACTCTGTC	CTTCTTGACATCTGAGTGCT
Twist	GGAGTCCGCAGTCTTACGAG	TCTGGAGGACCTGGTAGAGG
Vimentin	GGCTCAGAT TCAGGAACAGC	GCTTCAACGGCAAAGTTCTC
ZEB1	CAACTCCGATGAACTGCTGA	GAACCATTGGTGGTTGATCC
ZEB2	CAACTCCGATGAACTGCTGA	AGCCTGAGAGGAGGATCACA
18s	CAGCCACCCGAGATTGAGCA	TAGTAGCGACGGGCGGTGTG

Protein preparation and Western blot analysis

Extraction of cell proteins was performed using PRO-PREP^TM protein extract solution (iNtRON, Seongnam, Korea) and BCA reagent (Thermo Scientific, Sunnyvale, CA, USA) was used to determine the concentration. Protein extracts were boiled at 100℃ for 5 min in 4X Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) for denaturing. SDS-PAGE was performed using 7-15% polyacrylamide gels for the separation of equal amounts of the total protein per sample, which were then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) at 100 V for 1 h on ice. The membranes were blocked with 5% skim milk for 1 h at room temperature. After washing the membrane with tris-buffered saline with 0.1% Tween-20 (TBS-T) buffer for 30 min, the membranes were incubated with the following specific primary antibodies at 4℃ for 24 h; anti-E-cadherin, anti-N-cadherin, anti-vimentin, anti-Slug, and anti-β-actin (Cell Signaling Technology, Inc., Danvers, MA, USA). After washing with TBS-T, the membranes were incubated for 1 h with the appropriate horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (1:10,000, Santa Cruz, CA, USA) for 1 h at room temperature. A signal was developed using an enhanced EZ-Western Lumi Pico detection kit (Dogen, Seoul, Korea) using the Azure c300 western blot imaging system (Azure Biosystems, Dublin, CA, USA).

Migration assay

A cell migration assay was performed using a 24-transwell plate (Corning Life Sciences, Corning, NY, USA) with 8 μm-pore size polycarbonate membrane filter inserts. Briefly, 3 × 10⁵ and 9 × 10⁵ cells/mL were seeded into the insert, followed by the addition of DMEM to the lower chambers. After incubation for 24 or 48 h, non-migrating cells were removed from the surface of the upper chamber with cotton swabs. Migrating cells in the bottom chamber were fixed with 3% glutaraldehyde, followed by staining with crystal violet (Sigma-Aldrich). Crystal violet-stained cells were counted under a bright field light microscope. The experiments were performed in triplicate and each experiment was repeated five times.

Small interfering RNA (siRNA) preparation and transient siRNA knockdown

siRNA targeting Slug and its negative control siRNA were purchased from Integrated DNA Technologies (IDT Inc. Coralville, IA, USA). For transfection of siRNA, MCF-7/ADR cells were plated at 4 × 10⁵ cells per well in 6-well plates 24 h before experiments. The next day, cells were transfected with negative control at a concentration of 20 pmol for 24 h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) reagent according to the manufacturer’s protocol. In brief, before treatment, Lipofectamine 2000/siRNA complex was prepared and gently mixed in a serum-free medium, OptiMEM (Invitrogen), at the recommended ratio of 1:4 (v/v). For knock-down of the Slug gene, cells were treated with Lipofectamine 2000/ siRNA complex for 5 h, followed by incubation under normal cell culture conditions containing 10% FBS. Following incubation of the cells for 48 h or 72 h, the total RNA and proteins were isolated, respectively.

Statistical analysis

All results are presented as mean ± standard deviation (SD) and analysis was performed using a two-tailed Student’s t-test. Acceptable significance levels were set as p <0.05.

The effect of adriamycin on breast cancer cells and adriamycin-resistant breast bancer cells

To confirm adriamycin-resistance, MCF-7, and MCF-7/ADR cells were treated with various concentrations of ADR for analysis of cell viability using the MTT method. Significantly decreased levels of cell viability were detected in MCF-7 cells compared with MCF-7/ADR cells (Fig. 1A). Treatment with ADR resulted in remarkably increased cytotoxicity at a dose of 1 μM or higher in MCF-7 cells, whereas cell viability was not changed in MCF-7/ADR cells. RT-PCR was performed to determine the expression of MDR1 mRNA in MCF-7 and MCF-7/ADR cells (Fig. 1B). Significantly higher expression of MDR1 mRNA was observed in MCF-7/ADR cells compared with the levels detected in parental MCF-7 cells. As shown in Figure 1C, the observation of microphotographs showed distinct morphological changes in MCF-7 and MCF-7/ADR cells. These results indicated that MCF-7 cells showed greater sensitivity to ADR than MCF-7/ADR cells.

Figure 1. Characteristics of MCF-7/ADR cells compared with parental MCF-7 cells. (A) Effect of ADR on cell viability between parental MCF-7 and MCF-7/ADR cells. MCF-7 and MCF-7/ADR cells were treated with different concentrations of ADR for 48 h and measurement of cell viability was performed using the MTT assay. (B) Agarose gel electrophoresis was performed using RT-PCR to determine the expression levels of MDR-1 in MCF-7 and MCF-7/ADR cells. (C) Morphology of MCF-7 and MCF-7/ADR cells. Morphological differences were observed by optical microscopy using 200X magnification. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of E-cadherin, N-cadherin, fibronectin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2A). A significantly increased expression level of E-cadherin was detected in MCF-7 cells compared with MCF-7/ADR cells. However, remarkably reduced mRNA expression levels of N-cadherin, fibronectin, and vimentin were detected compared with MCF-7/ADR cells. Western blotting was performed to determine the protein levels of E-cadherin, N-cadherin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2B). Consistent with the results of RT-PCR, as previously mentioned, an increase was observed in the protein expression levels of E-cadherin while the levels of N-cadherin and vimentin were decreased in MCF-7 cells compared with MCF-7/ADR cells. These results suggested a close association between decreased expression of E-cadherin and induction of N-cadherin and vimentin in MCF-7/ADR cells with EMT. Over-expression of N-cadherin and vimentin has been reported to lead to the production of a mesenchymal phenotype, resulting in increased cell mobility and invasiveness. Therefore, a migration assay was performed to provide clarification regarding the involvement of EMT in MCF-7 and MCF-7/ADR cells (Fig. 2C). The results of trans-well migration assays showed significantly increased migration activity in MCF-7/ADR cells compared with MCF-7 cells. Taken together, these results indicated that cellular motility was dramatically increased in MCF-7/ADR cells, which has been implicated in EMT.

Figure 2. Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells. For analysis of (A) mRNA and (B) protein expression levels of EMT markers, MCF-7 and MCF-7/ADR cells were collected. The mRNA levels were normalized to the loading control 18s and proteins were normalized to the loading control β-actin. (C) Migration assay was performed in MCF-7 and MCF-7/ADR cells, and migrated cells were counted and plotted. The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells

RT-PCR was performed for quantification of Slug, Twist, ZEB1, and ZEB2 to confirm the EMT-associated transcription factors in MCF-7 and MCF-7/ADR cells. As shown in Fig. 3A, expression of Slug, ZEB1 and ZEB2 mRNA showed a dramatic increase in MCF-7/ADR cells, compared with MCF-7 cells. Of particular interest, the mRNA level of Slug detected in MCF-7/ADR cells was approximately 15-fold higher than the levels detected in parental MCF-7 cells. Thus, western blot analysis was performed to test the observed changes in the expression of Slug protein in MCF-7 and MCF-7/ADR cells (Fig. 3B). A significantly increased protein level of Slug was detected in MCF-7/ADR cells. These results provided proof of overexpression of Slug in MCF-7/ADR cells.

Figure 3. Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells. The mRNA expression levels of EMT-activating transcriptional factors in MCF-7 and MCF-7/ADR cells (Slug, Twist, ZEB1, and ZEB2) were analyzed using RT-PCR (A). The mRNA levels were normalized to the loading control 18s. (B) The total cell lysate was prepared and western blotting for Slug was performed. The protein levels were normalized to the loading control β-actin. ***significantly different from MCF-7 cells, p < 0.001.

Knock-down of Slug in MCF-7/Adr reversed EMT markers and motility

To clarify the function of Slug in MCF-7/ADR cells, transfection with siRNAs against Slug was performed and RT-PCR was performed to assess the concentration of specific transcription factors (Fig. 4A). Although Slug is inhibited by inhibitory molecules of siRNAs, no significant change in the expression levels of Twist, ZEB1, and ZEB2 was induced by siRNAs. The mRNA level of E-cadherin was significantly upregulated upon slug knockdown, whereas levels of N-cadherin, fibronectin, and vimentin were significantly downregulated (Fig. 4B). In addition, the silencing of Slug by its specific siRNA resulted in an obvious enhancement of the protein level of E-cadherin and a reduction of N-cadherin in MCF-7/ADR cells (Fig. 4C). Cell migration activity was further affected because Slug siRNA exhibited down-regulated levels of N-cadherin. As shown in Fig. 4D and 4E, the results of migration analysis showed that the knockdown of Slug in MCF-7/ADR cells was effective in decreasing the numbers of migrated cells compared to control cells. These findings suggest that the upward adjustment of Slug may have an important function in regulating the movement of MCF-7/ADR cells.

Figure 4. Knock-down of Slug in MCF-7/ADR reversed EMT markers and motility. RT-PCR was performed for the detection of the mRNA expression levels of transcriptional factors (A) and EMT markers (B). Western blotting was performed for the detection of the protein expression levels of EMT markers (C). Migration assay was performed in MCF-7 and MCF-7/ADR cells (D), and migrated cells were counted and plotted (E). The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. *, **, ***significantly different from Control siRNA cells, p < 0.05, p < 0.01, p < 0.001, respectively.

Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of MDR1 in Slug siRNA and MCF-7/ADR control cells (Fig. 5A). A decrease in the expression level of MDR1 was observed in Slug siRNA cells compared with MCF-7/ADR control cells. In addition, significantly decreased cell viability was observed after the treatment of Slug siRNA cells with ADR compared with MCF-7/ADR control cells by reduction of MDR1. Therefore, these findings suggested the potential usefulness of Slug as a candidate transcription factor capable of reducing resistance to ADR and the process of EMT in breast cancer patients.

Figure 5. Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells. The mRNA expression levels of MDR1 in control siRNA and Slug siRNA of MCF-7/ADR cells (A). MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation and harvesting for 72 h. (B) To assess the effect of ADR on cell viability, MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation for 72 h. Control siRNA, and Slug siRNA cells were treated with ADR for 24 h. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from control siRNA cells, p < 0.001.

Human breast cancer remains a commonly occurring disease with the involvement of genetic and epigenetic factors (Fang et al. 2014). Malignant tumors have the capacity for migration to different organs and invasion into surrounding tissue (Larue and Bellacosa 2005). Despite advancements in detection and therapeutic approaches, chemotherapeutic resistance is a critical issue in cancer treatment (Al-Hajj et al. 2003; Naumov et al. 2003; Rivera and Gomez 2010). Adriamycin is one of the primary drugs used in chemotherapy for cancer patients. However, recurrence and drug resistance are critical problems associated with the application of this therapy. Thus, increasing the sensitivity of cancer cells to adriamycin was a major purpose of this study.

Several transcription factors, including the Snail superfamily, Snail1 and Snail2 (Slug), bHLH family (Twist), and ZEB factors, ZEB1 and ZEB2, are involved in EMT phenotypic changes (Moreno-Bueno et al. 2008; Puisieux et al. 2014; Nieto et al. 2016). Of these, suppression of epithelial markers by Slug, which has a C2H2 zinc finger domain (DNA-binding domain), occurs through combination with an E-box of DNA sequences (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005; Lamouille et al. 2014). Upregulation of Slug in malignant breast cancer was reported in a recent study (He et al. 2012; Shen et al. 2017; Zhou et al. 2020). In this study, compared to MCF-7 cells, the expression of EMT-inducing transcription factors, except for Twist, was increased in ZEB1, ZEB2, and Slug in MCF-7/ADR cells, and the highest upregulation was observed in Slug (Fig. 3). In agreement with this, EMT markers showed diverse changes, including repression of E-cadherin, in MCF-7/ADR cells, indicating a close relation of phenotypic changes in these cells with the EMT phenomenon (Fig. 2).

In accumulating studies, evidence of distinct expression patterns and functional outcomes in cancer has been obtained through analyses of human tumors and experimental tumor models (Wiles et al. 2013; Robichaud et al. 2015; Kamiya et al. 2016; Zhang et al. 2016; Sun et al. 2018). A general EMT signature is shared across various cancer types, but the EMT-inducing transcription factors responsible for this reprogramming differ (Tan et al. 2014; Gibbons and Creighton 2018). While comparisons of expression and potential function in different tumor types suggest variations, no clear pattern of specific roles for different EMT-inducing transcription factors has been established thus far. In line with this, our results also indicate an unclear reason for the absence of differences in Twist levels between MCF-7 and MCF-7/ADR cells (Fig. 3), which will require further investigation in future studies.

Mesenchymal to epithelial transition (MET), the adversarial process of EMT, is commonly associated with the upregulation of E-cadherin (De Craene and Berx 2013; Lamouille et al. 2014). Our result showed upregulated expression of epithelial markers including E-cadherin in a Slug knockdown MCF-7/ADR cell model. In addition, downregulated expression of several other mesenchymal markers, particularly N-cadherin, fibronectin, and vimentin was observed when MCF-7/ADR cells were subjected to knockdown of Slug. Indeed, the knockdown of Slug resulted in efficient attenuation of cell migration, a critical functional test of EMT, in MCF-7/ADR cells, implying that the downregulation of Slug is a critical event in reducing the mobility of MCF-7/ADR cells subjected to Slug-induced EMT.

In addition, the knockdown of Slug in MCF-7/ADR cells resulted in significantly reduced drug resistance and downregulated expression of P-gp may have contributed to this outcome. Although the function of Slug knockdown in the down-regulation of P-gp expression was unclear in this study, other studies have also reported the involvement of EMT-activating transcription factors in the regulation of P-gp expression. A positive correlation was observed between Twist1 and the expression of P-gp in Hela cells derived from cervical cancer, and silencing of Twist1 resulted in the restoration of cisplatin sensitivity (Zhu et al. 2012).

Another study reported increased expression of EMT-activating transcription factors including Slug, Twist, and ZEB1/2, as well as P-gp in adriamycin-resistant breast cancer cells, indicating an association between EMT phenotypes and P-gp-mediated drug resistance (Tsou et al. 2015). In summary, these findings suggest the potential importance of Slug in the acquisition of mesenchymal characteristics as well as the expression of P-gp in adriamycin-resistant MCF-7 cells, which showed a significant reversal after the knockdown of Slug. Thus, suppression of EMT-activating transcription factor can be regarded as a promising strategy for the prevention of cancer progression and induction of chemotherapeutic sensitivity.

The authors declare that they have no conflict of interest.