검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

Article

Split Viewer

Original Research Article

DTT 2023; 2(1): 1-11

Published online March 31, 2023 https://doi.org/10.58502/DTT.23.0005

Copyright © The Pharmaceutical Society of Korea.

EMT-Activating Transcription Factor Slug is Involved in the Phenotypic Change as Well as Drug Sensitivity in Adriamycin- Resistant MCF-7 Cells

Sou Hyun Kim* , Mira Yu*, Young-Suk Jung

Department of Pharmacy, College of Pharmacy, Research Institute for Drug Development, Pusan National University, Busan, Korea

Correspondence to:Young-Suk Jung, youngjung@pusan.ac.kr
*These authors contributed equally to this work.

Received: January 30, 2023; Revised: March 3, 2023; Accepted: March 4, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ((http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Adriamycin is currently used in the treatment of breast cancer, however, acquired resistance to adriamycin is a critical problem. This study examined the gene expression involved in resistance to adriamycin in MCF-7 breast cancer cells, with a particular focus on the epithelial-mesenchymal transition (EMT). The level of E-cadherin, an epithelial marker, was significantly decreased, however, an obvious increase was observed in the levels of mesenchymal markers in adriamycin-resistant MCF-7 (MCF-7/ADR) cells, implying that EMT is induced by adriamycin resistance. In the evaluation of target transcription factors involved in EMT, Slug is predominantly expressed in MCF-7/ADR cells. Knockdown of Slug in MCF-7/ADR cells resulted in significant recovery of the epithelial characteristics. Of particular significance, the downregulation of Slug using siRNA resulted in repressed P-glycoprotein (P-gp) as well as increased sensitivity to adriamycin. Taken together, these findings suggest the potential importance of Slug in the acquisition of mesenchymal characteristics as well as the expression of P-gp in adriamycin-resistant MCF-7 cells.

Keywordsadriamycin, breast cancer, drug resistance, epithelial-mesenchymal transition, slug

Breast cancer, the most commonly diagnosed cancer in women, is the leading cause of cancer-related death (Shi et al. 2013; Yu et al. 2014; Famta et al. 2022). The application of multidisciplinary treatments that include surgery, hormonal therapy, radiation, and chemotherapy for patients with breast cancer has been reported (Prihantono and Faruk 2021). Among these, chemotherapy is still regarded as a major approach in the treatment of breast cancer (Famta et al. 2022). In particular, neoadjuvant chemotherapy, which has become the standard protocol for the management of locally advanced breast cancer, is the preferred treatment for operable breast cancer at an early stage. Anthracyclines, including adriamycin, as well as taxanes, cyclophosphamide, and platinum compounds are mainly used in the treatment of breast cancer patients (Caparica et al. 2019). In particular, adriamycin, an antibiotic belonging to the anthracycline group, is a highly sensitive alkylating chemotherapeutic drug used as a first-line adjuvant regimen in the treatment of breast cancer patients (Osman et al. 2012). Of particular interest, when the drug was administered as first-line single-agent therapy, a response was obtained in approximately 40% of patients with disseminated breast cancer (Bontenbal et al. 1998). A major issue affecting tumor patients is that repeated administration of adriamycin frequently has no effect and the tumor phenotype becomes more aggressive with high levels of P-glycoprotein (P-gp) expression. (Liu et al. 2008; Zhang et al. 2012). Despite significant advances in cancer diagnosis and treatment, chemoresistance, insensitivity of cancer cells to drug therapy, is the main cause of failure in the use of therapeutic strategies involving chemotherapy and results in disease progression (Szakács et al. 2006; Abotaleb et al. 2018).

Of the diverse mechanisms contributing to reduced drug sensitivity, increased drug efflux mediated by ATP-binding cassette superfamily proteins (ABC transporters) is a common phenomenon (Li et al. 2016). ABC transporters are ubiquitous in a variety of normal tissues including the brain, liver, intestine, placenta, kidney, and others; they are responsible for the regulation of distribution, absorption, and excretion of various xenobiotic compounds. Thus, it is thought that they are involved in protecting the body against toxic substances through their function as a detoxifier in normal cells (Fletcher et al. 2016). However, as a result of the increased expression of these transporters, the intracellular persistence of many anticancer drugs is reduced to sub-therapeutic levels, thus reducing or eliminating chemotherapeutic efficacy. P-gp, a well-known drug efflux pump belonging to the ABC transporter family, is a glycosylated transmembrane protein encoded by the ABCB1 gene. According to one study, overexpression of P-gp in cancers can be either intrinsic or acquired as a result of repeated administration of a drug, depending on the tissue of origin (Karthika et al. 2022). It can be activated by several factors, including antibiotics, analgesics, retinoic acid, sodium butyrate, UV irradiation, radiotherapy, and certain chemotherapeutic anticancer drugs (Kim 2002; Wang et al. 2012; Moitra 2015; Li et al. 2016). Overexpression of P-gp in cancer results in decreased accumulation of chemotherapeutics, leading to resistance against many currently available anti-cancer drugs including paclitaxel, vinblastine, and daunorubicin (Reed et al. 2010; Pote and Gacche 2023). Of note, a correlation of an increased level of ABC transporters with evasion of apoptosis, an increase in cell migration to provide the potential for invasion and metastasis, resulting in tumor aggressiveness has been reported (Fletcher et al. 2010; Zhang et al. 2014; Pote and Gacche 2023)

As a result of epithelial-mesenchymal transition (EMT), epithelial-derived carcinoma cells undergo a reversible process involving changes in cell-to-cell adhesion and polarity, cytoskeletal remodeling, enhanced migration and invasiveness, and dissemination to secondary organs; therefore, it is regarded as a pivotal process during cancer progression (Christofori 2006; Thiery and Sleeman 2006; Liu et al. 2013; Zheng and Kang 2014; Nieto et al. 2016). Of note, EMT has been reported to confer characteristics of drug resistance against several conventional therapeutic agents in human pancreatic cell lines, and against EGFR-targeted therapies in lung cancer (Fuchs et al. 2008; Sabbah et al. 2008; Arumugam et al. 2009; Abotaleb et al. 2018; Famta et al. 2022). Similar studies have also reported that an active EMT phenomenon in breast cancer cell lines renders them unresponsive to treatment with tamoxifen, paclitaxel, and adriamycin (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005). In addition, many studies have reported that mesenchymal tumors are more resistant to chemotherapy than epithelial tumors, and drug sensitivity is re-established upon reversal of the EMT phenotype observed in resistant cancer cell lines (Yauch et al. 2005; Carey et al. 2007; Liedtke et al. 2008; Arumugam et al. 2009; Li et al. 2009).

Despite various attempts to enhance the therapeutic effect of existing chemotherapeutic agents to overcome drug resistance in breast cancer, the effects remain unsatisfactory. The purpose of this study was to attain an understanding of the involvement of EMT in acquiring resistance to adriamycin and suggest potential therapeutic targets for reverting the mesenchymal state back to epithelial phenotype using adriamycin-resistant MCF-7 cells.

Cell lines and culture media

Human breast cancer cell lines were used in this study. MCF-7 breast cancer cell line and ADR-resistant MCF-7 (MCF-7/ADR) breast cancer cell lines were provided by Prof. Keun Wook Kang (Seoul National University, Seoul, Korea). All cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone) and 100 U/mL penicillin/streptomycin (GenDEPOT, Katy, TX, USA). MCF-7/ADR cell medium was further supplemented with ADR. All cells were maintained as monolayers in a humidified atmosphere containing 5% CO2 at 37℃ and the culture medium was replaced every three days.

Cell viability assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA) assay was used for the determination of cell viability. MTT was prepared at 5 mg/mL in phosphate-buffered saline (PBS, pH:7.2-7.4, Biosesang, Seongnam, Korea) and stored at 4℃. For the MTT assay, the cells were seeded in 96-well cell culture plates at a density of 1 × 104 cells per well. After 24 h, cells were treated with various concentrations of ADR, followed by incubation for 24 h or 48 h. The cells were incubated with 0.5 mg/mL MTT solution at 37℃ for 1 h for estimation of mitochondrial activity. Formazan crystals were dissolved in 100 µL of dimethyl sulfoxide (DMSO) and measurement of absorbance was performed at 540 nm using a MULTISKAN GO reader (Thermo Scientific, Waltham, MA, USA). The results are expressed as a percentage (%) of the results from vehicle-treated cells.

RNA extraction and RT-PCR

Total RNA was isolated using TRIzolTM purchased from Ambion (Life Technologies, Waltham, MT, USA). cDNA was generated by reverse transcription from mRNA using the iScriptTM cDNA Synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. Further amplification of the synthesized cDNAs was performed using polymerase chain reaction (PCR) using specific primers shown in Table 1. Total cDNA was used as a template for PCR, which was amplified in a 25 μL reaction mixture containing: 1 μg of DNA, 2.5 μL of 10X PCR buffer, 2 mM MgCl2, 10 mM dNTP mixture, one unit of Taq DNA polymerase, and 1 μM of sense and anti-sense primers. The PCR program was set to a cycle of 5 min at 94°C, 30 repetitive cycles of 94°C for 30 s, 45-55°C for 30-40 s, 72°C for 1 min, as well as at 72°C for 7 min, respectively. All PCR reactions were performed in a GeneAmp PCR 2700 system (Applied Biosystems, Foster City, CA, USA), and electrophoresis was performed in 1% agarose gels using 1X TBE buffer containing 0.5 μg/mL ethidium bromide (Sigma-Aldrich) for visualization of products of PCR amplification. For calculation of the final, normalized results, the relative transcript levels of target genes were divided by the relative transcript levels of 18s.

Table 1 Primer sequences used in PCR amplification

SymbolPrimer sequence (5’-3’)
ForwardReverse
E-cadherinTCCATTTCTTGGTCTACGCCCACCTTCAGCCATCCTGTTT
FibronectinTCGAGGAGGAAATTCCAATGCTCTTCATGACGCTTGTGGA
N-cadherinACAGTGGCCACCTACAAAGGTGATCCCTCAGGAACTGTCC
SlugGAGCATACAGCCCCATCACTGCAGTGAGGGCAAGAAAAAG
SnailAATGCTCATCTGGGACTCTGTCCTTCTTGACATCTGAGTGCT
TwistGGAGTCCGCAGTCTTACGAGTCTGGAGGACCTGGTAGAGG
VimentinGGCTCAGAT TCAGGAACAGCGCTTCAACGGCAAAGTTCTC
ZEB1CAACTCCGATGAACTGCTGAGAACCATTGGTGGTTGATCC
ZEB2CAACTCCGATGAACTGCTGAAGCCTGAGAGGAGGATCACA
18sCAGCCACCCGAGATTGAGCATAGTAGCGACGGGCGGTGTG

Protein preparation and Western blot analysis

Extraction of cell proteins was performed using PRO-PREPTM protein extract solution (iNtRON, Seongnam, Korea) and BCA reagent (Thermo Scientific, Sunnyvale, CA, USA) was used to determine the concentration. Protein extracts were boiled at 100℃ for 5 min in 4X Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) for denaturing. SDS-PAGE was performed using 7-15% polyacrylamide gels for the separation of equal amounts of the total protein per sample, which were then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) at 100 V for 1 h on ice. The membranes were blocked with 5% skim milk for 1 h at room temperature. After washing the membrane with tris-buffered saline with 0.1% Tween-20 (TBS-T) buffer for 30 min, the membranes were incubated with the following specific primary antibodies at 4℃ for 24 h; anti-E-cadherin, anti-N-cadherin, anti-vimentin, anti-Slug, and anti-β-actin (Cell Signaling Technology, Inc., Danvers, MA, USA). After washing with TBS-T, the membranes were incubated for 1 h with the appropriate horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (1:10,000, Santa Cruz, CA, USA) for 1 h at room temperature. A signal was developed using an enhanced EZ-Western Lumi Pico detection kit (Dogen, Seoul, Korea) using the Azure c300 western blot imaging system (Azure Biosystems, Dublin, CA, USA).

Migration assay

A cell migration assay was performed using a 24-transwell plate (Corning Life Sciences, Corning, NY, USA) with 8 μm-pore size polycarbonate membrane filter inserts. Briefly, 3 × 105 and 9 × 105 cells/mL were seeded into the insert, followed by the addition of DMEM to the lower chambers. After incubation for 24 or 48 h, non-migrating cells were removed from the surface of the upper chamber with cotton swabs. Migrating cells in the bottom chamber were fixed with 3% glutaraldehyde, followed by staining with crystal violet (Sigma-Aldrich). Crystal violet-stained cells were counted under a bright field light microscope. The experiments were performed in triplicate and each experiment was repeated five times.

Small interfering RNA (siRNA) preparation and transient siRNA knockdown

siRNA targeting Slug and its negative control siRNA were purchased from Integrated DNA Technologies (IDT Inc. Coralville, IA, USA). For transfection of siRNA, MCF-7/ADR cells were plated at 4 × 105 cells per well in 6-well plates 24 h before experiments. The next day, cells were transfected with negative control at a concentration of 20 pmol for 24 h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) reagent according to the manufacturer’s protocol. In brief, before treatment, Lipofectamine 2000/siRNA complex was prepared and gently mixed in a serum-free medium, OptiMEM (Invitrogen), at the recommended ratio of 1:4 (v/v). For knock-down of the Slug gene, cells were treated with Lipofectamine 2000/ siRNA complex for 5 h, followed by incubation under normal cell culture conditions containing 10% FBS. Following incubation of the cells for 48 h or 72 h, the total RNA and proteins were isolated, respectively.

Statistical analysis

All results are presented as mean ± standard deviation (SD) and analysis was performed using a two-tailed Student’s t-test. Acceptable significance levels were set as p <0.05.

The effect of adriamycin on breast cancer cells and adriamycin-resistant breast bancer cells

To confirm adriamycin-resistance, MCF-7, and MCF-7/ADR cells were treated with various concentrations of ADR for analysis of cell viability using the MTT method. Significantly decreased levels of cell viability were detected in MCF-7 cells compared with MCF-7/ADR cells (Fig. 1A). Treatment with ADR resulted in remarkably increased cytotoxicity at a dose of 1 μM or higher in MCF-7 cells, whereas cell viability was not changed in MCF-7/ADR cells. RT-PCR was performed to determine the expression of MDR1 mRNA in MCF-7 and MCF-7/ADR cells (Fig. 1B). Significantly higher expression of MDR1 mRNA was observed in MCF-7/ADR cells compared with the levels detected in parental MCF-7 cells. As shown in Figure 1C, the observation of microphotographs showed distinct morphological changes in MCF-7 and MCF-7/ADR cells. These results indicated that MCF-7 cells showed greater sensitivity to ADR than MCF-7/ADR cells.

Figure 1.Characteristics of MCF-7/ADR cells compared with parental MCF-7 cells. (A) Effect of ADR on cell viability between parental MCF-7 and MCF-7/ADR cells. MCF-7 and MCF-7/ADR cells were treated with different concentrations of ADR for 48 h and measurement of cell viability was performed using the MTT assay. (B) Agarose gel electrophoresis was performed using RT-PCR to determine the expression levels of MDR-1 in MCF-7 and MCF-7/ADR cells. (C) Morphology of MCF-7 and MCF-7/ADR cells. Morphological differences were observed by optical microscopy using 200X magnification. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of E-cadherin, N-cadherin, fibronectin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2A). A significantly increased expression level of E-cadherin was detected in MCF-7 cells compared with MCF-7/ADR cells. However, remarkably reduced mRNA expression levels of N-cadherin, fibronectin, and vimentin were detected compared with MCF-7/ADR cells. Western blotting was performed to determine the protein levels of E-cadherin, N-cadherin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2B). Consistent with the results of RT-PCR, as previously mentioned, an increase was observed in the protein expression levels of E-cadherin while the levels of N-cadherin and vimentin were decreased in MCF-7 cells compared with MCF-7/ADR cells. These results suggested a close association between decreased expression of E-cadherin and induction of N-cadherin and vimentin in MCF-7/ADR cells with EMT. Over-expression of N-cadherin and vimentin has been reported to lead to the production of a mesenchymal phenotype, resulting in increased cell mobility and invasiveness. Therefore, a migration assay was performed to provide clarification regarding the involvement of EMT in MCF-7 and MCF-7/ADR cells (Fig. 2C). The results of trans-well migration assays showed significantly increased migration activity in MCF-7/ADR cells compared with MCF-7 cells. Taken together, these results indicated that cellular motility was dramatically increased in MCF-7/ADR cells, which has been implicated in EMT.

Figure 2.Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells. For analysis of (A) mRNA and (B) protein expression levels of EMT markers, MCF-7 and MCF-7/ADR cells were collected. The mRNA levels were normalized to the loading control 18s and proteins were normalized to the loading control β-actin. (C) Migration assay was performed in MCF-7 and MCF-7/ADR cells, and migrated cells were counted and plotted. The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells

RT-PCR was performed for quantification of Slug, Twist, ZEB1, and ZEB2 to confirm the EMT-associated transcription factors in MCF-7 and MCF-7/ADR cells. As shown in Fig. 3A, expression of Slug, ZEB1 and ZEB2 mRNA showed a dramatic increase in MCF-7/ADR cells, compared with MCF-7 cells. Of particular interest, the mRNA level of Slug detected in MCF-7/ADR cells was approximately 15-fold higher than the levels detected in parental MCF-7 cells. Thus, western blot analysis was performed to test the observed changes in the expression of Slug protein in MCF-7 and MCF-7/ADR cells (Fig. 3B). A significantly increased protein level of Slug was detected in MCF-7/ADR cells. These results provided proof of overexpression of Slug in MCF-7/ADR cells.

Figure 3.Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells. The mRNA expression levels of EMT-activating transcriptional factors in MCF-7 and MCF-7/ADR cells (Slug, Twist, ZEB1, and ZEB2) were analyzed using RT-PCR (A). The mRNA levels were normalized to the loading control 18s. (B) The total cell lysate was prepared and western blotting for Slug was performed. The protein levels were normalized to the loading control β-actin. ***significantly different from MCF-7 cells, p < 0.001.

Knock-down of Slug in MCF-7/Adr reversed EMT markers and motility

To clarify the function of Slug in MCF-7/ADR cells, transfection with siRNAs against Slug was performed and RT-PCR was performed to assess the concentration of specific transcription factors (Fig. 4A). Although Slug is inhibited by inhibitory molecules of siRNAs, no significant change in the expression levels of Twist, ZEB1, and ZEB2 was induced by siRNAs. The mRNA level of E-cadherin was significantly upregulated upon slug knockdown, whereas levels of N-cadherin, fibronectin, and vimentin were significantly downregulated (Fig. 4B). In addition, the silencing of Slug by its specific siRNA resulted in an obvious enhancement of the protein level of E-cadherin and a reduction of N-cadherin in MCF-7/ADR cells (Fig. 4C). Cell migration activity was further affected because Slug siRNA exhibited down-regulated levels of N-cadherin. As shown in Fig. 4D and 4E, the results of migration analysis showed that the knockdown of Slug in MCF-7/ADR cells was effective in decreasing the numbers of migrated cells compared to control cells. These findings suggest that the upward adjustment of Slug may have an important function in regulating the movement of MCF-7/ADR cells.

Figure 4.Knock-down of Slug in MCF-7/ADR reversed EMT markers and motility. RT-PCR was performed for the detection of the mRNA expression levels of transcriptional factors (A) and EMT markers (B). Western blotting was performed for the detection of the protein expression levels of EMT markers (C). Migration assay was performed in MCF-7 and MCF-7/ADR cells (D), and migrated cells were counted and plotted (E). The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. *, **, ***significantly different from Control siRNA cells, p < 0.05, p < 0.01, p < 0.001, respectively.

Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of MDR1 in Slug siRNA and MCF-7/ADR control cells (Fig. 5A). A decrease in the expression level of MDR1 was observed in Slug siRNA cells compared with MCF-7/ADR control cells. In addition, significantly decreased cell viability was observed after the treatment of Slug siRNA cells with ADR compared with MCF-7/ADR control cells by reduction of MDR1. Therefore, these findings suggested the potential usefulness of Slug as a candidate transcription factor capable of reducing resistance to ADR and the process of EMT in breast cancer patients.

Figure 5.Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells. The mRNA expression levels of MDR1 in control siRNA and Slug siRNA of MCF-7/ADR cells (A). MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation and harvesting for 72 h. (B) To assess the effect of ADR on cell viability, MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation for 72 h. Control siRNA, and Slug siRNA cells were treated with ADR for 24 h. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from control siRNA cells, p < 0.001.

Human breast cancer remains a commonly occurring disease with the involvement of genetic and epigenetic factors (Fang et al. 2014). Malignant tumors have the capacity for migration to different organs and invasion into surrounding tissue (Larue and Bellacosa 2005). Despite advancements in detection and therapeutic approaches, chemotherapeutic resistance is a critical issue in cancer treatment (Al-Hajj et al. 2003; Naumov et al. 2003; Rivera and Gomez 2010). Adriamycin is one of the primary drugs used in chemotherapy for cancer patients. However, recurrence and drug resistance are critical problems associated with the application of this therapy. Thus, increasing the sensitivity of cancer cells to adriamycin was a major purpose of this study.

Several transcription factors, including the Snail superfamily, Snail1 and Snail2 (Slug), bHLH family (Twist), and ZEB factors, ZEB1 and ZEB2, are involved in EMT phenotypic changes (Moreno-Bueno et al. 2008; Puisieux et al. 2014; Nieto et al. 2016). Of these, suppression of epithelial markers by Slug, which has a C2H2 zinc finger domain (DNA-binding domain), occurs through combination with an E-box of DNA sequences (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005; Lamouille et al. 2014). Upregulation of Slug in malignant breast cancer was reported in a recent study (He et al. 2012; Shen et al. 2017; Zhou et al. 2020). In this study, compared to MCF-7 cells, the expression of EMT-inducing transcription factors, except for Twist, was increased in ZEB1, ZEB2, and Slug in MCF-7/ADR cells, and the highest upregulation was observed in Slug (Fig. 3). In agreement with this, EMT markers showed diverse changes, including repression of E-cadherin, in MCF-7/ADR cells, indicating a close relation of phenotypic changes in these cells with the EMT phenomenon (Fig. 2).

In accumulating studies, evidence of distinct expression patterns and functional outcomes in cancer has been obtained through analyses of human tumors and experimental tumor models (Wiles et al. 2013; Robichaud et al. 2015; Kamiya et al. 2016; Zhang et al. 2016; Sun et al. 2018). A general EMT signature is shared across various cancer types, but the EMT-inducing transcription factors responsible for this reprogramming differ (Tan et al. 2014; Gibbons and Creighton 2018). While comparisons of expression and potential function in different tumor types suggest variations, no clear pattern of specific roles for different EMT-inducing transcription factors has been established thus far. In line with this, our results also indicate an unclear reason for the absence of differences in Twist levels between MCF-7 and MCF-7/ADR cells (Fig. 3), which will require further investigation in future studies.

Mesenchymal to epithelial transition (MET), the adversarial process of EMT, is commonly associated with the upregulation of E-cadherin (De Craene and Berx 2013; Lamouille et al. 2014). Our result showed upregulated expression of epithelial markers including E-cadherin in a Slug knockdown MCF-7/ADR cell model. In addition, downregulated expression of several other mesenchymal markers, particularly N-cadherin, fibronectin, and vimentin was observed when MCF-7/ADR cells were subjected to knockdown of Slug. Indeed, the knockdown of Slug resulted in efficient attenuation of cell migration, a critical functional test of EMT, in MCF-7/ADR cells, implying that the downregulation of Slug is a critical event in reducing the mobility of MCF-7/ADR cells subjected to Slug-induced EMT.

In addition, the knockdown of Slug in MCF-7/ADR cells resulted in significantly reduced drug resistance and downregulated expression of P-gp may have contributed to this outcome. Although the function of Slug knockdown in the down-regulation of P-gp expression was unclear in this study, other studies have also reported the involvement of EMT-activating transcription factors in the regulation of P-gp expression. A positive correlation was observed between Twist1 and the expression of P-gp in Hela cells derived from cervical cancer, and silencing of Twist1 resulted in the restoration of cisplatin sensitivity (Zhu et al. 2012).

Another study reported increased expression of EMT-activating transcription factors including Slug, Twist, and ZEB1/2, as well as P-gp in adriamycin-resistant breast cancer cells, indicating an association between EMT phenotypes and P-gp-mediated drug resistance (Tsou et al. 2015). In summary, these findings suggest the potential importance of Slug in the acquisition of mesenchymal characteristics as well as the expression of P-gp in adriamycin-resistant MCF-7 cells, which showed a significant reversal after the knockdown of Slug. Thus, suppression of EMT-activating transcription factor can be regarded as a promising strategy for the prevention of cancer progression and induction of chemotherapeutic sensitivity.

The authors declare that they have no conflict of interest.

  1. Abotaleb M, Kubatka P, Caprnda M, Varghese E, Zolakova B, Zubor P, Opatrilova R, Kruzliak P, Stefanicka P, Büsselberg D (2018) Chemotherapeutic agents for the treatment of metastatic breast cancer: an update. Biomed Pharmacother 101:458-477. doi: 10.1016/j.biopha.2018.02.108
    Pubmed CrossRef
  2. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003) Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100:3983-3988. doi: 10.1073/pnas.0530291100. Erratum in: (2003) Proc Natl Acad Sci U S A 100:6890.
    Pubmed KoreaMed CrossRef
  3. Arumugam T, Ramachandran V, Fournier KF, Wang H, Marquis L, Abbruzzese JL, Gallick GE, Logsdon CD, McConkey DJ, Choi W (2009) Epithelial to mesenchymal transition contributes to drug resistance in pancreatic cancer. Cancer Res 69:5820-5828. doi: 10.1158/0008-5472.CAN-08-2819
    Pubmed KoreaMed CrossRef
  4. Bontenbal M, Sieuwerts AM, Peters HA, van Putten WL, Foekens JA, Klijn JG (1998) Uptake and distribution of doxorubicin in hormone-manipulated human breast cancer cells in vitro. Breast Cancer Res Treat 51:139-148. doi: 10.1023/a:1006026015448
    Pubmed CrossRef
  5. Caparica R, Bruzzone M, Poggio F, Ceppi M, de Azambuja E, Lambertini M (2019) Anthracycline and taxane-based chemotherapy versus docetaxel and cyclophosphamide in the adjuvant treatment of HER2-negative breast cancer patients: a systematic review and meta-analysis of randomized controlled trials. Breast Cancer Res Treat 174:27-37. doi: 10.1007/s10549-018-5055-9
    Pubmed CrossRef
  6. Carey LA, Dees EC, Sawyer L, Gatti L, Moore DT, Collichio F, Ollila DW, Sartor CI, Graham ML, Perou CM (2007) The triple negative paradox: primary tumor chemosensitivity of breast cancer subtypes. Clin Cancer Res 13:2329-2334. doi: 10.1158/1078-0432.CCR-06-1109
    Pubmed CrossRef
  7. Christofori G (2006) New signals from the invasive front. Nature 441:444-450. doi: 10.1038/nature04872
    Pubmed CrossRef
  8. De Craene B, Berx G (2013) Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer 13:97-110. doi: 10.1038/nrc3447
    Pubmed CrossRef
  9. De Craene B, van Roy F, Berx G (2005) Unraveling signalling cascades for the Snail family of transcription factors. Cell Signal 17:535-547. doi: 10.1016/j.cellsig.2004.10.011
    Pubmed CrossRef
  10. Famta P, Shah S, Jain N, Kumar KC, Bagasariya D, Khatri DK, Raghuvanshi RS, Singh SB, Srivastava S (2022) Tumor-promoting aftermath post-chemotherapy: a focus on breast cancer. Life Sci 310:121125. doi: 10.1016/j.lfs.2022.121125
    Pubmed CrossRef
  11. Fang Y, Shen H, Cao Y, Li H, Qin R, Chen Q, Long L, Zhu XL, Xie CJ, Xu WL (2014) Involvement of miR-30c in resistance to doxorubicin by regulating YWHAZ in breast cancer cells. Braz J Med Biol Res 47:60-69. doi: 10.1590/1414-431X20133324
    Pubmed KoreaMed CrossRef
  12. Fletcher JI, Haber M, Henderson MJ, Norris MD (2010) ABC transporters in cancer: more than just drug efflux pumps. Nat Rev Cancer 10:147-156. doi: 10.1038/nrc2789
    Pubmed CrossRef
  13. Fletcher JI, Williams RT, Henderson MJ, Norris MD, Haber M (2016) ABC transporters as mediators of drug resistance and contributors to cancer cell biology. Drug Resist Updat 26:1-9. doi: 10.1016/j.drup.2016.03.001
    Pubmed CrossRef
  14. Fuchs BC, Fujii T, Dorfman JD, Goodwin JM, Zhu AX, Lanuti M, Tanabe KK (2008) Epithelial-to-mesenchymal transition and integrin-linked kinase mediate sensitivity to epidermal growth factor receptor inhibition in human hepatoma cells. Cancer Res 68:2391-2399. doi: 10.1158/0008-5472.CAN-07-2460
    Pubmed CrossRef
  15. Gibbons DL, Creighton CJ (2018) Pan-cancer survey of epithelial-mesenchymal transition markers across the Cancer Genome Atlas. Dev Dyn 247:555-564. doi: 10.1002/dvdy.24485
    Pubmed KoreaMed CrossRef
  16. He LC, Gao FH, Xu HZ, Zhao S, Ma CM, Li J, Zhang S, Wu YL (2012) Ikaros inhibits proliferation and, through upregulation of Slug, increases metastatic ability of ovarian serous adenocarcinoma cells. Oncol Rep 28:1399-1405. doi: 10.3892/or.2012.1946
    Pubmed CrossRef
  17. Kamiya T, Goto A, Kurokawa E, Hara H, Adachi T (2016) Cross talk mechanism among EMT, ROS, and histone acetylation in phorbol ester-treated human breast cancer MCF-7 cells. Oxid Med Cell Longev 2016:1284372. doi: 10.1155/2016/1284372
    Pubmed KoreaMed CrossRef
  18. Kang Y, Massagué J (2004) Epithelial-mesenchymal transitions: twist in development and metastasis. Cell 118:277-279. doi: 10.1016/j.cell.2004.07.011
    Pubmed CrossRef
  19. Karthika C, Sureshkumar R, Zehravi M, Akter R, Ali F, Ramproshad S, Mondal B, Tagde P, Ahmed Z, Khan FS, Rahman MH, Cavalu S (2022) Multidrug resistance of cancer cells and the vital role of P-glycoprotein. Life (Basel) 12:897. doi: 10.3390/life12060897
    Pubmed KoreaMed CrossRef
  20. Kim RB (2002) Drugs as P-glycoprotein substrates, inhibitors, and inducers. Drug Metab Rev 34:47-54. doi: 10.1081/dmr-120001389
    Pubmed CrossRef
  21. Lamouille S, Xu J, Derynck R (2014) Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 15:178-196. doi: 10.1038/nrm3758
    Pubmed KoreaMed CrossRef
  22. Larue L, Bellacosa A (2005) Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3' kinase/AKT pathways. Oncogene 24:7443-7454. doi: 10.1038/sj.onc.1209091
    Pubmed CrossRef
  23. Li W, Zhang H, Assaraf YG, Zhao K, Xu X, Xie J, Yang DH, Chen ZS (2016) Overcoming ABC transporter-mediated multidrug resistance: molecular mechanisms and novel therapeutic drug strategies. Drug Resist Updat 27:14-29. doi: 10.1016/j.drup.2016.05.001
    Pubmed CrossRef
  24. Li Y, VandenBoom TG 2nd, Kong D, Wang Z, Ali S, Philip PA, Sarkar FH (2009) Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res 69:6704-6712. doi: 10.1158/0008-5472.CAN-09-1298
    Pubmed KoreaMed CrossRef
  25. Liedtke C, Mazouni C, Hess KR, André F, Tordai A, Mejia JA, Symmans WF, Gonzalez-Angulo AM, Hennessy B, Green M, Cristofanilli M, Hortobagyi GN, Pusztai L (2008) Response to neoadjuvant therapy and long-term survival in patients with triple-negative breast cancer. J Clin Oncol 26:1275-1281. doi: 10.1200/JCO.2007.14.4147
    Pubmed CrossRef
  26. Liu H, Liu Y, Zhang JT (2008) A new mechanism of drug resistance in breast cancer cells: fatty acid synthase overexpression-mediated palmitate overproduction. Mol Cancer Ther 7:263-270. doi: 10.1158/1535-7163.MCT-07-0445
    Pubmed CrossRef
  27. Liu J, Hu G, Chen D, Gong AY, Soori GS, Dobleman TJ, Chen XM (2013) Suppression of SCARA5 by Snail1 is essential for EMT-associated cell migration of A549 cells. Oncogenesis 2:e73. doi: 10.1038/oncsis.2013.37
    Pubmed KoreaMed CrossRef
  28. Moitra K (2015) Overcoming multidrug resistance in cancer stem cells. Biomed Res Int 2015:635745. doi: 10.1155/2015/635745
    Pubmed KoreaMed CrossRef
  29. Moreno-Bueno G, Portillo F, Cano A (2008) Transcriptional regulation of cell polarity in EMT and cancer. Oncogene 27:6958-6969. doi: 10.1038/onc.2008.346
    Pubmed CrossRef
  30. Naumov GN, Townson JL, MacDonald IC, Wilson SM, Bramwell VH, Groom AC, Chambers AF (2003) Ineffectiveness of doxorubicin treatment on solitary dormant mammary carcinoma cells or late-developing metastases. Breast Cancer Res Treat 82:199-206. doi: 10.1023/B:BREA.0000004377.12288.3c
    Pubmed CrossRef
  31. Nieto MA, Huang RY, Jackson RA, Thiery JP (2016) EMT: 2016. Cell 166:21-45. doi: 10.1016/j.cell.2016.06.028
    Pubmed CrossRef
  32. Osman AM, Bayoumi HM, Al-Harthi SE, Damanhouri ZA, Elshal MF (2012) Modulation of doxorubicin cytotoxicity by resveratrol in a human breast cancer cell line. Cancer Cell Int 12:47. doi: 10.1186/1475-2867-12-47
    Pubmed KoreaMed CrossRef
  33. Peinado H, Ballestar E, Esteller M, Cano A (2004) Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 24:306-319. doi: 10.1128/MCB.24.1.306-319.2004
    Pubmed KoreaMed CrossRef
  34. Pote MS, Gacche RN (2023) ATP-binding cassette efflux transporters and MDR in cancer. Drug Discov Today. doi: 10.1016/j.drudis.2023.103537
    Pubmed CrossRef
  35. Prihantono, Faruk M (2021) Breast cancer resistance to chemotherapy: when should we suspect it and how can we prevent it? Ann Med Surg (Lond) 70:102793. doi: 10.1016/j.amsu.2021.102793
    Pubmed KoreaMed CrossRef
  36. Puisieux A, Brabletz T, Caramel J (2014) Oncogenic roles of EMT-inducing transcription factors. Nat Cell Biol 16:488-494. doi: 10.1038/ncb2976
    Pubmed CrossRef
  37. Reed K, Poulin ML, Yan L, Parissenti AM (2010) Comparison of bisulfite sequencing PCR with pyrosequencing for measuring differences in DNA methylation. Anal Biochem 397:96-106. doi: 10.1016/j.ab.2009.10.021
    Pubmed CrossRef
  38. Rivera E, Gomez H (2010) Chemotherapy resistance in metastatic breast cancer: the evolving role of ixabepilone. Breast Cancer Res 12(Suppl 2):S2. doi: 10.1186/bcr2573
    Pubmed KoreaMed CrossRef
  39. Robichaud N, del Rincon SV, Huor B, Alain T, Petruccelli LA, Hearnden J, Goncalves C, Grotegut S, Spruck CH, Furic L, Larsson O, Muller WJ, Miller WH, Sonenberg N (2015) Phosphorylation of eIF4E promotes EMT and metastasis via translational control of SNAIL and MMP-3. Oncogene 34:2032-2042. doi: 10.1038/onc.2014.146
    Pubmed KoreaMed CrossRef
  40. Sabbah M, Emami S, Redeuilh G, Julien S, Prévost G, Zimber A, Ouelaa R, Bracke M, De Wever O, Gespach C (2008) Molecular signature and therapeutic perspective of the epithelial-to-mesenchymal transitions in epithelial cancers. Drug Resist Updat 11:123-151. doi: 10.1016/j.drup.2008.07.001
    Pubmed CrossRef
  41. Shen CJ, Kuo YL, Chen CC, Chen MJ, Cheng YM (2017) MMP1 expression is activated by Slug and enhances multi-drug resistance (MDR) in breast cancer. PLoS One 12:e0174487. doi: 10.1371/journal.pone.0174487
    Pubmed KoreaMed CrossRef
  42. Shi XP, Miao S, Wu Y, Zhang W, Zhang XF, Ma HZ, Xin HL, Feng J, Wen AD, Li Y (2013) Resveratrol sensitizes tamoxifen in antiestrogen-resistant breast cancer cells with epithelial-mesenchymal transition features. Int J Mol Sci 14:15655-15668. doi: 10.3390/ijms140815655
    Pubmed KoreaMed CrossRef
  43. Sun Q, Lesperance J, Wettersten H, Luterstein E, DeRose YS, Welm A, Cheresh DA, Desgrosellier JS (2018) Proapoptotic PUMA targets stem-like breast cancer cells to suppress metastasis. J Clin Invest 128:531-544. doi: 10.1172/JCI93707
    Pubmed KoreaMed CrossRef
  44. Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM (2006) Targeting multidrug resistance in cancer. Nat Rev Drug Discov 5:219-234. doi: 10.1038/nrd1984
    Pubmed CrossRef
  45. Tan TZ, Miow QH, Miki Y, Noda T, Mori S, Huang RY, Thiery JP (2014) Epithelial-mesenchymal transition spectrum quantification and its efficacy in deciphering survival and drug responses of cancer patients. EMBO Mol Med 6:1279-1293. doi: 10.15252/emmm.201404208
    Pubmed KoreaMed CrossRef
  46. Thiery JP, Sleeman JP (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol 7:131-142. doi: 10.1038/nrm1835
    Pubmed CrossRef
  47. Tsou SH, Chen TM, Hsiao HT, Chen YH (2015) A critical dose of doxorubicin is required to alter the gene expression profiles in MCF-7 cells acquiring multidrug resistance. PLoS One 10:e0116747. doi: 10.1371/journal.pone.0116747
    Pubmed KoreaMed CrossRef
  48. Wang Y, Chen Q, Jin S, Deng W, Li S, Tong Q, Chen Y (2012) Up-regulation of P-glycoprotein is involved in the increased paclitaxel resistance in human esophageal cancer radioresistant cells. Scand J Gastroenterol 47:802-808. doi: 10.3109/00365521.2012.683042
    Pubmed CrossRef
  49. Wiles ET, Bell R, Thomas D, Beckerle M, Lessnick SL (2013) ZEB2 represses the epithelial phenotype and facilitates metastasis in Ewing sarcoma. Genes Cancer 4:486-500. doi: 10.1177/1947601913506115
    Pubmed KoreaMed CrossRef
  50. Yauch RL, Januario T, Eberhard DA, Cavet G, Zhu W, Fu L, Pham TQ, Soriano R, Stinson J, Seshagiri S, Modrusan Z, Lin CY, O'Neill V, Amler LC (2005) Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res 11(24 Pt 1):8686-8698. doi: 10.1158/1078-0432.CCR-05-1492
    Pubmed CrossRef
  51. Yu Y, Xiao CH, Tan LD, Wang QS, Li XQ, Feng YM (2014) Cancer-associated fibroblasts induce epithelial-mesenchymal transition of breast cancer cells through paracrine TGF-β signalling. Br J Cancer 110:724-732. doi: 10.1038/bjc.2013.768
    Pubmed KoreaMed CrossRef
  52. Zhang F, Zhang H, Wang Z, Yu M, Tian R, Ji W, Yang Y, Niu R (2014) P-glycoprotein associates with Anxa2 and promotes invasion in multidrug resistant breast cancer cells. Biochem Pharmacol 87:292-302. doi: 10.1016/j.bcp.2013.11.003
    Pubmed CrossRef
  53. Zhang HC, Zhang F, Wu B, Han JH, Ji W, Zhou Y, Niu RF (2012) Identification of the interaction between P-Glycoprotein and Anxa2 in multidrug-resistant human breast cancer cells. Cancer Biol Med 9:99-104. doi: 10.3969/j.issn.2095-3941.2012.02.003
  54. Zhang T, Guo L, Creighton CJ, Lu Q, Gibbons DL, Yi ES, Deng B, Molina JR, Sun Z, Yang P, Yang Y (2016) A genetic cell context-dependent role for ZEB1 in lung cancer. Nat Commun 7:12231. doi: 10.1038/ncomms12231
    Pubmed KoreaMed CrossRef
  55. Zheng H, Kang Y (2014) Multilayer control of the EMT master regulators. Oncogene 33:1755-1763. doi: 10.1038/onc.2013.128
    Pubmed CrossRef
  56. Zhou L, Wang D, Sheng D, Xu J, Chen W, Qin Y, Du R, Yang X, He X, Xie N, Liu S, Zhang L (2020) NOTCH4 maintains quiescent mesenchymal-like breast cancer stem cells via transcriptionally activating SLUG and GAS1 in triple-negative breast cancer. Theranostics 10:2405-2421. doi: 10.7150/thno.38875
    Pubmed KoreaMed CrossRef
  57. Zhu K, Chen L, Han X, Wang J, Wang J (2012) Short hairpin RNA targeting Twist1 suppresses cell proliferation and improves chemosensitivity to cisplatin in HeLa human cervical cancer cells. Oncol Rep 27:1027-1034. doi: 10.3892/or.2012.1633
    Pubmed KoreaMed CrossRef

Article

Original Research Article

DTT 2023; 2(1): 1-11

Published online March 31, 2023 https://doi.org/10.58502/DTT.23.0005

Copyright © The Pharmaceutical Society of Korea.

EMT-Activating Transcription Factor Slug is Involved in the Phenotypic Change as Well as Drug Sensitivity in Adriamycin- Resistant MCF-7 Cells

Sou Hyun Kim* , Mira Yu*, Young-Suk Jung

Department of Pharmacy, College of Pharmacy, Research Institute for Drug Development, Pusan National University, Busan, Korea

Correspondence to:Young-Suk Jung, youngjung@pusan.ac.kr
*These authors contributed equally to this work.

Received: January 30, 2023; Revised: March 3, 2023; Accepted: March 4, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ((http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Adriamycin is currently used in the treatment of breast cancer, however, acquired resistance to adriamycin is a critical problem. This study examined the gene expression involved in resistance to adriamycin in MCF-7 breast cancer cells, with a particular focus on the epithelial-mesenchymal transition (EMT). The level of E-cadherin, an epithelial marker, was significantly decreased, however, an obvious increase was observed in the levels of mesenchymal markers in adriamycin-resistant MCF-7 (MCF-7/ADR) cells, implying that EMT is induced by adriamycin resistance. In the evaluation of target transcription factors involved in EMT, Slug is predominantly expressed in MCF-7/ADR cells. Knockdown of Slug in MCF-7/ADR cells resulted in significant recovery of the epithelial characteristics. Of particular significance, the downregulation of Slug using siRNA resulted in repressed P-glycoprotein (P-gp) as well as increased sensitivity to adriamycin. Taken together, these findings suggest the potential importance of Slug in the acquisition of mesenchymal characteristics as well as the expression of P-gp in adriamycin-resistant MCF-7 cells.

Keywords: adriamycin, breast cancer, drug resistance, epithelial-mesenchymal transition, slug

Introduction

Breast cancer, the most commonly diagnosed cancer in women, is the leading cause of cancer-related death (Shi et al. 2013; Yu et al. 2014; Famta et al. 2022). The application of multidisciplinary treatments that include surgery, hormonal therapy, radiation, and chemotherapy for patients with breast cancer has been reported (Prihantono and Faruk 2021). Among these, chemotherapy is still regarded as a major approach in the treatment of breast cancer (Famta et al. 2022). In particular, neoadjuvant chemotherapy, which has become the standard protocol for the management of locally advanced breast cancer, is the preferred treatment for operable breast cancer at an early stage. Anthracyclines, including adriamycin, as well as taxanes, cyclophosphamide, and platinum compounds are mainly used in the treatment of breast cancer patients (Caparica et al. 2019). In particular, adriamycin, an antibiotic belonging to the anthracycline group, is a highly sensitive alkylating chemotherapeutic drug used as a first-line adjuvant regimen in the treatment of breast cancer patients (Osman et al. 2012). Of particular interest, when the drug was administered as first-line single-agent therapy, a response was obtained in approximately 40% of patients with disseminated breast cancer (Bontenbal et al. 1998). A major issue affecting tumor patients is that repeated administration of adriamycin frequently has no effect and the tumor phenotype becomes more aggressive with high levels of P-glycoprotein (P-gp) expression. (Liu et al. 2008; Zhang et al. 2012). Despite significant advances in cancer diagnosis and treatment, chemoresistance, insensitivity of cancer cells to drug therapy, is the main cause of failure in the use of therapeutic strategies involving chemotherapy and results in disease progression (Szakács et al. 2006; Abotaleb et al. 2018).

Of the diverse mechanisms contributing to reduced drug sensitivity, increased drug efflux mediated by ATP-binding cassette superfamily proteins (ABC transporters) is a common phenomenon (Li et al. 2016). ABC transporters are ubiquitous in a variety of normal tissues including the brain, liver, intestine, placenta, kidney, and others; they are responsible for the regulation of distribution, absorption, and excretion of various xenobiotic compounds. Thus, it is thought that they are involved in protecting the body against toxic substances through their function as a detoxifier in normal cells (Fletcher et al. 2016). However, as a result of the increased expression of these transporters, the intracellular persistence of many anticancer drugs is reduced to sub-therapeutic levels, thus reducing or eliminating chemotherapeutic efficacy. P-gp, a well-known drug efflux pump belonging to the ABC transporter family, is a glycosylated transmembrane protein encoded by the ABCB1 gene. According to one study, overexpression of P-gp in cancers can be either intrinsic or acquired as a result of repeated administration of a drug, depending on the tissue of origin (Karthika et al. 2022). It can be activated by several factors, including antibiotics, analgesics, retinoic acid, sodium butyrate, UV irradiation, radiotherapy, and certain chemotherapeutic anticancer drugs (Kim 2002; Wang et al. 2012; Moitra 2015; Li et al. 2016). Overexpression of P-gp in cancer results in decreased accumulation of chemotherapeutics, leading to resistance against many currently available anti-cancer drugs including paclitaxel, vinblastine, and daunorubicin (Reed et al. 2010; Pote and Gacche 2023). Of note, a correlation of an increased level of ABC transporters with evasion of apoptosis, an increase in cell migration to provide the potential for invasion and metastasis, resulting in tumor aggressiveness has been reported (Fletcher et al. 2010; Zhang et al. 2014; Pote and Gacche 2023)

As a result of epithelial-mesenchymal transition (EMT), epithelial-derived carcinoma cells undergo a reversible process involving changes in cell-to-cell adhesion and polarity, cytoskeletal remodeling, enhanced migration and invasiveness, and dissemination to secondary organs; therefore, it is regarded as a pivotal process during cancer progression (Christofori 2006; Thiery and Sleeman 2006; Liu et al. 2013; Zheng and Kang 2014; Nieto et al. 2016). Of note, EMT has been reported to confer characteristics of drug resistance against several conventional therapeutic agents in human pancreatic cell lines, and against EGFR-targeted therapies in lung cancer (Fuchs et al. 2008; Sabbah et al. 2008; Arumugam et al. 2009; Abotaleb et al. 2018; Famta et al. 2022). Similar studies have also reported that an active EMT phenomenon in breast cancer cell lines renders them unresponsive to treatment with tamoxifen, paclitaxel, and adriamycin (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005). In addition, many studies have reported that mesenchymal tumors are more resistant to chemotherapy than epithelial tumors, and drug sensitivity is re-established upon reversal of the EMT phenotype observed in resistant cancer cell lines (Yauch et al. 2005; Carey et al. 2007; Liedtke et al. 2008; Arumugam et al. 2009; Li et al. 2009).

Despite various attempts to enhance the therapeutic effect of existing chemotherapeutic agents to overcome drug resistance in breast cancer, the effects remain unsatisfactory. The purpose of this study was to attain an understanding of the involvement of EMT in acquiring resistance to adriamycin and suggest potential therapeutic targets for reverting the mesenchymal state back to epithelial phenotype using adriamycin-resistant MCF-7 cells.

Materials|Methods

Cell lines and culture media

Human breast cancer cell lines were used in this study. MCF-7 breast cancer cell line and ADR-resistant MCF-7 (MCF-7/ADR) breast cancer cell lines were provided by Prof. Keun Wook Kang (Seoul National University, Seoul, Korea). All cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone) and 100 U/mL penicillin/streptomycin (GenDEPOT, Katy, TX, USA). MCF-7/ADR cell medium was further supplemented with ADR. All cells were maintained as monolayers in a humidified atmosphere containing 5% CO2 at 37℃ and the culture medium was replaced every three days.

Cell viability assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA) assay was used for the determination of cell viability. MTT was prepared at 5 mg/mL in phosphate-buffered saline (PBS, pH:7.2-7.4, Biosesang, Seongnam, Korea) and stored at 4℃. For the MTT assay, the cells were seeded in 96-well cell culture plates at a density of 1 × 104 cells per well. After 24 h, cells were treated with various concentrations of ADR, followed by incubation for 24 h or 48 h. The cells were incubated with 0.5 mg/mL MTT solution at 37℃ for 1 h for estimation of mitochondrial activity. Formazan crystals were dissolved in 100 µL of dimethyl sulfoxide (DMSO) and measurement of absorbance was performed at 540 nm using a MULTISKAN GO reader (Thermo Scientific, Waltham, MA, USA). The results are expressed as a percentage (%) of the results from vehicle-treated cells.

RNA extraction and RT-PCR

Total RNA was isolated using TRIzolTM purchased from Ambion (Life Technologies, Waltham, MT, USA). cDNA was generated by reverse transcription from mRNA using the iScriptTM cDNA Synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. Further amplification of the synthesized cDNAs was performed using polymerase chain reaction (PCR) using specific primers shown in Table 1. Total cDNA was used as a template for PCR, which was amplified in a 25 μL reaction mixture containing: 1 μg of DNA, 2.5 μL of 10X PCR buffer, 2 mM MgCl2, 10 mM dNTP mixture, one unit of Taq DNA polymerase, and 1 μM of sense and anti-sense primers. The PCR program was set to a cycle of 5 min at 94°C, 30 repetitive cycles of 94°C for 30 s, 45-55°C for 30-40 s, 72°C for 1 min, as well as at 72°C for 7 min, respectively. All PCR reactions were performed in a GeneAmp PCR 2700 system (Applied Biosystems, Foster City, CA, USA), and electrophoresis was performed in 1% agarose gels using 1X TBE buffer containing 0.5 μg/mL ethidium bromide (Sigma-Aldrich) for visualization of products of PCR amplification. For calculation of the final, normalized results, the relative transcript levels of target genes were divided by the relative transcript levels of 18s.

Table 1 . Primer sequences used in PCR amplification.

SymbolPrimer sequence (5’-3’)
ForwardReverse
E-cadherinTCCATTTCTTGGTCTACGCCCACCTTCAGCCATCCTGTTT
FibronectinTCGAGGAGGAAATTCCAATGCTCTTCATGACGCTTGTGGA
N-cadherinACAGTGGCCACCTACAAAGGTGATCCCTCAGGAACTGTCC
SlugGAGCATACAGCCCCATCACTGCAGTGAGGGCAAGAAAAAG
SnailAATGCTCATCTGGGACTCTGTCCTTCTTGACATCTGAGTGCT
TwistGGAGTCCGCAGTCTTACGAGTCTGGAGGACCTGGTAGAGG
VimentinGGCTCAGAT TCAGGAACAGCGCTTCAACGGCAAAGTTCTC
ZEB1CAACTCCGATGAACTGCTGAGAACCATTGGTGGTTGATCC
ZEB2CAACTCCGATGAACTGCTGAAGCCTGAGAGGAGGATCACA
18sCAGCCACCCGAGATTGAGCATAGTAGCGACGGGCGGTGTG


Protein preparation and Western blot analysis

Extraction of cell proteins was performed using PRO-PREPTM protein extract solution (iNtRON, Seongnam, Korea) and BCA reagent (Thermo Scientific, Sunnyvale, CA, USA) was used to determine the concentration. Protein extracts were boiled at 100℃ for 5 min in 4X Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) for denaturing. SDS-PAGE was performed using 7-15% polyacrylamide gels for the separation of equal amounts of the total protein per sample, which were then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) at 100 V for 1 h on ice. The membranes were blocked with 5% skim milk for 1 h at room temperature. After washing the membrane with tris-buffered saline with 0.1% Tween-20 (TBS-T) buffer for 30 min, the membranes were incubated with the following specific primary antibodies at 4℃ for 24 h; anti-E-cadherin, anti-N-cadherin, anti-vimentin, anti-Slug, and anti-β-actin (Cell Signaling Technology, Inc., Danvers, MA, USA). After washing with TBS-T, the membranes were incubated for 1 h with the appropriate horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (1:10,000, Santa Cruz, CA, USA) for 1 h at room temperature. A signal was developed using an enhanced EZ-Western Lumi Pico detection kit (Dogen, Seoul, Korea) using the Azure c300 western blot imaging system (Azure Biosystems, Dublin, CA, USA).

Migration assay

A cell migration assay was performed using a 24-transwell plate (Corning Life Sciences, Corning, NY, USA) with 8 μm-pore size polycarbonate membrane filter inserts. Briefly, 3 × 105 and 9 × 105 cells/mL were seeded into the insert, followed by the addition of DMEM to the lower chambers. After incubation for 24 or 48 h, non-migrating cells were removed from the surface of the upper chamber with cotton swabs. Migrating cells in the bottom chamber were fixed with 3% glutaraldehyde, followed by staining with crystal violet (Sigma-Aldrich). Crystal violet-stained cells were counted under a bright field light microscope. The experiments were performed in triplicate and each experiment was repeated five times.

Small interfering RNA (siRNA) preparation and transient siRNA knockdown

siRNA targeting Slug and its negative control siRNA were purchased from Integrated DNA Technologies (IDT Inc. Coralville, IA, USA). For transfection of siRNA, MCF-7/ADR cells were plated at 4 × 105 cells per well in 6-well plates 24 h before experiments. The next day, cells were transfected with negative control at a concentration of 20 pmol for 24 h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) reagent according to the manufacturer’s protocol. In brief, before treatment, Lipofectamine 2000/siRNA complex was prepared and gently mixed in a serum-free medium, OptiMEM (Invitrogen), at the recommended ratio of 1:4 (v/v). For knock-down of the Slug gene, cells were treated with Lipofectamine 2000/ siRNA complex for 5 h, followed by incubation under normal cell culture conditions containing 10% FBS. Following incubation of the cells for 48 h or 72 h, the total RNA and proteins were isolated, respectively.

Statistical analysis

All results are presented as mean ± standard deviation (SD) and analysis was performed using a two-tailed Student’s t-test. Acceptable significance levels were set as p <0.05.

Results

The effect of adriamycin on breast cancer cells and adriamycin-resistant breast bancer cells

To confirm adriamycin-resistance, MCF-7, and MCF-7/ADR cells were treated with various concentrations of ADR for analysis of cell viability using the MTT method. Significantly decreased levels of cell viability were detected in MCF-7 cells compared with MCF-7/ADR cells (Fig. 1A). Treatment with ADR resulted in remarkably increased cytotoxicity at a dose of 1 μM or higher in MCF-7 cells, whereas cell viability was not changed in MCF-7/ADR cells. RT-PCR was performed to determine the expression of MDR1 mRNA in MCF-7 and MCF-7/ADR cells (Fig. 1B). Significantly higher expression of MDR1 mRNA was observed in MCF-7/ADR cells compared with the levels detected in parental MCF-7 cells. As shown in Figure 1C, the observation of microphotographs showed distinct morphological changes in MCF-7 and MCF-7/ADR cells. These results indicated that MCF-7 cells showed greater sensitivity to ADR than MCF-7/ADR cells.

Figure 1. Characteristics of MCF-7/ADR cells compared with parental MCF-7 cells. (A) Effect of ADR on cell viability between parental MCF-7 and MCF-7/ADR cells. MCF-7 and MCF-7/ADR cells were treated with different concentrations of ADR for 48 h and measurement of cell viability was performed using the MTT assay. (B) Agarose gel electrophoresis was performed using RT-PCR to determine the expression levels of MDR-1 in MCF-7 and MCF-7/ADR cells. (C) Morphology of MCF-7 and MCF-7/ADR cells. Morphological differences were observed by optical microscopy using 200X magnification. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of E-cadherin, N-cadherin, fibronectin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2A). A significantly increased expression level of E-cadherin was detected in MCF-7 cells compared with MCF-7/ADR cells. However, remarkably reduced mRNA expression levels of N-cadherin, fibronectin, and vimentin were detected compared with MCF-7/ADR cells. Western blotting was performed to determine the protein levels of E-cadherin, N-cadherin, and vimentin in MCF-7 and MCF-7/ADR cells (Fig. 2B). Consistent with the results of RT-PCR, as previously mentioned, an increase was observed in the protein expression levels of E-cadherin while the levels of N-cadherin and vimentin were decreased in MCF-7 cells compared with MCF-7/ADR cells. These results suggested a close association between decreased expression of E-cadherin and induction of N-cadherin and vimentin in MCF-7/ADR cells with EMT. Over-expression of N-cadherin and vimentin has been reported to lead to the production of a mesenchymal phenotype, resulting in increased cell mobility and invasiveness. Therefore, a migration assay was performed to provide clarification regarding the involvement of EMT in MCF-7 and MCF-7/ADR cells (Fig. 2C). The results of trans-well migration assays showed significantly increased migration activity in MCF-7/ADR cells compared with MCF-7 cells. Taken together, these results indicated that cellular motility was dramatically increased in MCF-7/ADR cells, which has been implicated in EMT.

Figure 2. Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells. For analysis of (A) mRNA and (B) protein expression levels of EMT markers, MCF-7 and MCF-7/ADR cells were collected. The mRNA levels were normalized to the loading control 18s and proteins were normalized to the loading control β-actin. (C) Migration assay was performed in MCF-7 and MCF-7/ADR cells, and migrated cells were counted and plotted. The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.

Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells

RT-PCR was performed for quantification of Slug, Twist, ZEB1, and ZEB2 to confirm the EMT-associated transcription factors in MCF-7 and MCF-7/ADR cells. As shown in Fig. 3A, expression of Slug, ZEB1 and ZEB2 mRNA showed a dramatic increase in MCF-7/ADR cells, compared with MCF-7 cells. Of particular interest, the mRNA level of Slug detected in MCF-7/ADR cells was approximately 15-fold higher than the levels detected in parental MCF-7 cells. Thus, western blot analysis was performed to test the observed changes in the expression of Slug protein in MCF-7 and MCF-7/ADR cells (Fig. 3B). A significantly increased protein level of Slug was detected in MCF-7/ADR cells. These results provided proof of overexpression of Slug in MCF-7/ADR cells.

Figure 3. Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells. The mRNA expression levels of EMT-activating transcriptional factors in MCF-7 and MCF-7/ADR cells (Slug, Twist, ZEB1, and ZEB2) were analyzed using RT-PCR (A). The mRNA levels were normalized to the loading control 18s. (B) The total cell lysate was prepared and western blotting for Slug was performed. The protein levels were normalized to the loading control β-actin. ***significantly different from MCF-7 cells, p < 0.001.

Knock-down of Slug in MCF-7/Adr reversed EMT markers and motility

To clarify the function of Slug in MCF-7/ADR cells, transfection with siRNAs against Slug was performed and RT-PCR was performed to assess the concentration of specific transcription factors (Fig. 4A). Although Slug is inhibited by inhibitory molecules of siRNAs, no significant change in the expression levels of Twist, ZEB1, and ZEB2 was induced by siRNAs. The mRNA level of E-cadherin was significantly upregulated upon slug knockdown, whereas levels of N-cadherin, fibronectin, and vimentin were significantly downregulated (Fig. 4B). In addition, the silencing of Slug by its specific siRNA resulted in an obvious enhancement of the protein level of E-cadherin and a reduction of N-cadherin in MCF-7/ADR cells (Fig. 4C). Cell migration activity was further affected because Slug siRNA exhibited down-regulated levels of N-cadherin. As shown in Fig. 4D and 4E, the results of migration analysis showed that the knockdown of Slug in MCF-7/ADR cells was effective in decreasing the numbers of migrated cells compared to control cells. These findings suggest that the upward adjustment of Slug may have an important function in regulating the movement of MCF-7/ADR cells.

Figure 4. Knock-down of Slug in MCF-7/ADR reversed EMT markers and motility. RT-PCR was performed for the detection of the mRNA expression levels of transcriptional factors (A) and EMT markers (B). Western blotting was performed for the detection of the protein expression levels of EMT markers (C). Migration assay was performed in MCF-7 and MCF-7/ADR cells (D), and migrated cells were counted and plotted (E). The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. *, **, ***significantly different from Control siRNA cells, p < 0.05, p < 0.01, p < 0.001, respectively.

Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells

RT-PCR was performed for the detection of mRNA expression levels of MDR1 in Slug siRNA and MCF-7/ADR control cells (Fig. 5A). A decrease in the expression level of MDR1 was observed in Slug siRNA cells compared with MCF-7/ADR control cells. In addition, significantly decreased cell viability was observed after the treatment of Slug siRNA cells with ADR compared with MCF-7/ADR control cells by reduction of MDR1. Therefore, these findings suggested the potential usefulness of Slug as a candidate transcription factor capable of reducing resistance to ADR and the process of EMT in breast cancer patients.

Figure 5. Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells. The mRNA expression levels of MDR1 in control siRNA and Slug siRNA of MCF-7/ADR cells (A). MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation and harvesting for 72 h. (B) To assess the effect of ADR on cell viability, MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation for 72 h. Control siRNA, and Slug siRNA cells were treated with ADR for 24 h. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from control siRNA cells, p < 0.001.

Discussion

Human breast cancer remains a commonly occurring disease with the involvement of genetic and epigenetic factors (Fang et al. 2014). Malignant tumors have the capacity for migration to different organs and invasion into surrounding tissue (Larue and Bellacosa 2005). Despite advancements in detection and therapeutic approaches, chemotherapeutic resistance is a critical issue in cancer treatment (Al-Hajj et al. 2003; Naumov et al. 2003; Rivera and Gomez 2010). Adriamycin is one of the primary drugs used in chemotherapy for cancer patients. However, recurrence and drug resistance are critical problems associated with the application of this therapy. Thus, increasing the sensitivity of cancer cells to adriamycin was a major purpose of this study.

Several transcription factors, including the Snail superfamily, Snail1 and Snail2 (Slug), bHLH family (Twist), and ZEB factors, ZEB1 and ZEB2, are involved in EMT phenotypic changes (Moreno-Bueno et al. 2008; Puisieux et al. 2014; Nieto et al. 2016). Of these, suppression of epithelial markers by Slug, which has a C2H2 zinc finger domain (DNA-binding domain), occurs through combination with an E-box of DNA sequences (Kang and Massagué 2004; Peinado et al. 2004; De Craene et al. 2005; Lamouille et al. 2014). Upregulation of Slug in malignant breast cancer was reported in a recent study (He et al. 2012; Shen et al. 2017; Zhou et al. 2020). In this study, compared to MCF-7 cells, the expression of EMT-inducing transcription factors, except for Twist, was increased in ZEB1, ZEB2, and Slug in MCF-7/ADR cells, and the highest upregulation was observed in Slug (Fig. 3). In agreement with this, EMT markers showed diverse changes, including repression of E-cadherin, in MCF-7/ADR cells, indicating a close relation of phenotypic changes in these cells with the EMT phenomenon (Fig. 2).

In accumulating studies, evidence of distinct expression patterns and functional outcomes in cancer has been obtained through analyses of human tumors and experimental tumor models (Wiles et al. 2013; Robichaud et al. 2015; Kamiya et al. 2016; Zhang et al. 2016; Sun et al. 2018). A general EMT signature is shared across various cancer types, but the EMT-inducing transcription factors responsible for this reprogramming differ (Tan et al. 2014; Gibbons and Creighton 2018). While comparisons of expression and potential function in different tumor types suggest variations, no clear pattern of specific roles for different EMT-inducing transcription factors has been established thus far. In line with this, our results also indicate an unclear reason for the absence of differences in Twist levels between MCF-7 and MCF-7/ADR cells (Fig. 3), which will require further investigation in future studies.

Mesenchymal to epithelial transition (MET), the adversarial process of EMT, is commonly associated with the upregulation of E-cadherin (De Craene and Berx 2013; Lamouille et al. 2014). Our result showed upregulated expression of epithelial markers including E-cadherin in a Slug knockdown MCF-7/ADR cell model. In addition, downregulated expression of several other mesenchymal markers, particularly N-cadherin, fibronectin, and vimentin was observed when MCF-7/ADR cells were subjected to knockdown of Slug. Indeed, the knockdown of Slug resulted in efficient attenuation of cell migration, a critical functional test of EMT, in MCF-7/ADR cells, implying that the downregulation of Slug is a critical event in reducing the mobility of MCF-7/ADR cells subjected to Slug-induced EMT.

In addition, the knockdown of Slug in MCF-7/ADR cells resulted in significantly reduced drug resistance and downregulated expression of P-gp may have contributed to this outcome. Although the function of Slug knockdown in the down-regulation of P-gp expression was unclear in this study, other studies have also reported the involvement of EMT-activating transcription factors in the regulation of P-gp expression. A positive correlation was observed between Twist1 and the expression of P-gp in Hela cells derived from cervical cancer, and silencing of Twist1 resulted in the restoration of cisplatin sensitivity (Zhu et al. 2012).

Another study reported increased expression of EMT-activating transcription factors including Slug, Twist, and ZEB1/2, as well as P-gp in adriamycin-resistant breast cancer cells, indicating an association between EMT phenotypes and P-gp-mediated drug resistance (Tsou et al. 2015). In summary, these findings suggest the potential importance of Slug in the acquisition of mesenchymal characteristics as well as the expression of P-gp in adriamycin-resistant MCF-7 cells, which showed a significant reversal after the knockdown of Slug. Thus, suppression of EMT-activating transcription factor can be regarded as a promising strategy for the prevention of cancer progression and induction of chemotherapeutic sensitivity.

Conflict of interest

The authors declare that they have no conflict of interest.

Fig 1.

Figure 1.Characteristics of MCF-7/ADR cells compared with parental MCF-7 cells. (A) Effect of ADR on cell viability between parental MCF-7 and MCF-7/ADR cells. MCF-7 and MCF-7/ADR cells were treated with different concentrations of ADR for 48 h and measurement of cell viability was performed using the MTT assay. (B) Agarose gel electrophoresis was performed using RT-PCR to determine the expression levels of MDR-1 in MCF-7 and MCF-7/ADR cells. (C) Morphology of MCF-7 and MCF-7/ADR cells. Morphological differences were observed by optical microscopy using 200X magnification. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.
Drug Targets and Therapeutics 2023; 2: 1-11https://doi.org/10.58502/DTT.23.0005

Fig 2.

Figure 2.Comparison of the EMT parameters between MCF-7 cells and MCF-7/ADR cells. For analysis of (A) mRNA and (B) protein expression levels of EMT markers, MCF-7 and MCF-7/ADR cells were collected. The mRNA levels were normalized to the loading control 18s and proteins were normalized to the loading control β-actin. (C) Migration assay was performed in MCF-7 and MCF-7/ADR cells, and migrated cells were counted and plotted. The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from MCF-7 cells, p < 0.001.
Drug Targets and Therapeutics 2023; 2: 1-11https://doi.org/10.58502/DTT.23.0005

Fig 3.

Figure 3.Differential expression of EMT activating transcriptional factors in MCF-7/ADR cells. The mRNA expression levels of EMT-activating transcriptional factors in MCF-7 and MCF-7/ADR cells (Slug, Twist, ZEB1, and ZEB2) were analyzed using RT-PCR (A). The mRNA levels were normalized to the loading control 18s. (B) The total cell lysate was prepared and western blotting for Slug was performed. The protein levels were normalized to the loading control β-actin. ***significantly different from MCF-7 cells, p < 0.001.
Drug Targets and Therapeutics 2023; 2: 1-11https://doi.org/10.58502/DTT.23.0005

Fig 4.

Figure 4.Knock-down of Slug in MCF-7/ADR reversed EMT markers and motility. RT-PCR was performed for the detection of the mRNA expression levels of transcriptional factors (A) and EMT markers (B). Western blotting was performed for the detection of the protein expression levels of EMT markers (C). Migration assay was performed in MCF-7 and MCF-7/ADR cells (D), and migrated cells were counted and plotted (E). The number of migrated cells was counted from three random areas per experiment by optical microscopy using 200X magnification and an average was taken. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. *, **, ***significantly different from Control siRNA cells, p < 0.05, p < 0.01, p < 0.001, respectively.
Drug Targets and Therapeutics 2023; 2: 1-11https://doi.org/10.58502/DTT.23.0005

Fig 5.

Figure 5.Effect of knock-down of Slug on the expression of MDR1 and adriamycin-induced cell death in MCF-7/ADR cells. The mRNA expression levels of MDR1 in control siRNA and Slug siRNA of MCF-7/ADR cells (A). MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation and harvesting for 72 h. (B) To assess the effect of ADR on cell viability, MCF-7/ADR cells were transfected with Lipofectamine 2000/ Slug siRNA complex for 5 h, followed by incubation for 72 h. Control siRNA, and Slug siRNA cells were treated with ADR for 24 h. The results were expressed as mean ± standard deviation (SD) of triplicate independent experiments. ***significantly different from control siRNA cells, p < 0.001.
Drug Targets and Therapeutics 2023; 2: 1-11https://doi.org/10.58502/DTT.23.0005

Table 1 Primer sequences used in PCR amplification

SymbolPrimer sequence (5’-3’)
ForwardReverse
E-cadherinTCCATTTCTTGGTCTACGCCCACCTTCAGCCATCCTGTTT
FibronectinTCGAGGAGGAAATTCCAATGCTCTTCATGACGCTTGTGGA
N-cadherinACAGTGGCCACCTACAAAGGTGATCCCTCAGGAACTGTCC
SlugGAGCATACAGCCCCATCACTGCAGTGAGGGCAAGAAAAAG
SnailAATGCTCATCTGGGACTCTGTCCTTCTTGACATCTGAGTGCT
TwistGGAGTCCGCAGTCTTACGAGTCTGGAGGACCTGGTAGAGG
VimentinGGCTCAGAT TCAGGAACAGCGCTTCAACGGCAAAGTTCTC
ZEB1CAACTCCGATGAACTGCTGAGAACCATTGGTGGTTGATCC
ZEB2CAACTCCGATGAACTGCTGAAGCCTGAGAGGAGGATCACA
18sCAGCCACCCGAGATTGAGCATAGTAGCGACGGGCGGTGTG

References

  1. Abotaleb M, Kubatka P, Caprnda M, Varghese E, Zolakova B, Zubor P, Opatrilova R, Kruzliak P, Stefanicka P, Büsselberg D (2018) Chemotherapeutic agents for the treatment of metastatic breast cancer: an update. Biomed Pharmacother 101:458-477. doi: 10.1016/j.biopha.2018.02.108
    Pubmed CrossRef
  2. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003) Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100:3983-3988. doi: 10.1073/pnas.0530291100. Erratum in: (2003) Proc Natl Acad Sci U S A 100:6890.
    Pubmed KoreaMed CrossRef
  3. Arumugam T, Ramachandran V, Fournier KF, Wang H, Marquis L, Abbruzzese JL, Gallick GE, Logsdon CD, McConkey DJ, Choi W (2009) Epithelial to mesenchymal transition contributes to drug resistance in pancreatic cancer. Cancer Res 69:5820-5828. doi: 10.1158/0008-5472.CAN-08-2819
    Pubmed KoreaMed CrossRef
  4. Bontenbal M, Sieuwerts AM, Peters HA, van Putten WL, Foekens JA, Klijn JG (1998) Uptake and distribution of doxorubicin in hormone-manipulated human breast cancer cells in vitro. Breast Cancer Res Treat 51:139-148. doi: 10.1023/a:1006026015448
    Pubmed CrossRef
  5. Caparica R, Bruzzone M, Poggio F, Ceppi M, de Azambuja E, Lambertini M (2019) Anthracycline and taxane-based chemotherapy versus docetaxel and cyclophosphamide in the adjuvant treatment of HER2-negative breast cancer patients: a systematic review and meta-analysis of randomized controlled trials. Breast Cancer Res Treat 174:27-37. doi: 10.1007/s10549-018-5055-9
    Pubmed CrossRef
  6. Carey LA, Dees EC, Sawyer L, Gatti L, Moore DT, Collichio F, Ollila DW, Sartor CI, Graham ML, Perou CM (2007) The triple negative paradox: primary tumor chemosensitivity of breast cancer subtypes. Clin Cancer Res 13:2329-2334. doi: 10.1158/1078-0432.CCR-06-1109
    Pubmed CrossRef
  7. Christofori G (2006) New signals from the invasive front. Nature 441:444-450. doi: 10.1038/nature04872
    Pubmed CrossRef
  8. De Craene B, Berx G (2013) Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer 13:97-110. doi: 10.1038/nrc3447
    Pubmed CrossRef
  9. De Craene B, van Roy F, Berx G (2005) Unraveling signalling cascades for the Snail family of transcription factors. Cell Signal 17:535-547. doi: 10.1016/j.cellsig.2004.10.011
    Pubmed CrossRef
  10. Famta P, Shah S, Jain N, Kumar KC, Bagasariya D, Khatri DK, Raghuvanshi RS, Singh SB, Srivastava S (2022) Tumor-promoting aftermath post-chemotherapy: a focus on breast cancer. Life Sci 310:121125. doi: 10.1016/j.lfs.2022.121125
    Pubmed CrossRef
  11. Fang Y, Shen H, Cao Y, Li H, Qin R, Chen Q, Long L, Zhu XL, Xie CJ, Xu WL (2014) Involvement of miR-30c in resistance to doxorubicin by regulating YWHAZ in breast cancer cells. Braz J Med Biol Res 47:60-69. doi: 10.1590/1414-431X20133324
    Pubmed KoreaMed CrossRef
  12. Fletcher JI, Haber M, Henderson MJ, Norris MD (2010) ABC transporters in cancer: more than just drug efflux pumps. Nat Rev Cancer 10:147-156. doi: 10.1038/nrc2789
    Pubmed CrossRef
  13. Fletcher JI, Williams RT, Henderson MJ, Norris MD, Haber M (2016) ABC transporters as mediators of drug resistance and contributors to cancer cell biology. Drug Resist Updat 26:1-9. doi: 10.1016/j.drup.2016.03.001
    Pubmed CrossRef
  14. Fuchs BC, Fujii T, Dorfman JD, Goodwin JM, Zhu AX, Lanuti M, Tanabe KK (2008) Epithelial-to-mesenchymal transition and integrin-linked kinase mediate sensitivity to epidermal growth factor receptor inhibition in human hepatoma cells. Cancer Res 68:2391-2399. doi: 10.1158/0008-5472.CAN-07-2460
    Pubmed CrossRef
  15. Gibbons DL, Creighton CJ (2018) Pan-cancer survey of epithelial-mesenchymal transition markers across the Cancer Genome Atlas. Dev Dyn 247:555-564. doi: 10.1002/dvdy.24485
    Pubmed KoreaMed CrossRef
  16. He LC, Gao FH, Xu HZ, Zhao S, Ma CM, Li J, Zhang S, Wu YL (2012) Ikaros inhibits proliferation and, through upregulation of Slug, increases metastatic ability of ovarian serous adenocarcinoma cells. Oncol Rep 28:1399-1405. doi: 10.3892/or.2012.1946
    Pubmed CrossRef
  17. Kamiya T, Goto A, Kurokawa E, Hara H, Adachi T (2016) Cross talk mechanism among EMT, ROS, and histone acetylation in phorbol ester-treated human breast cancer MCF-7 cells. Oxid Med Cell Longev 2016:1284372. doi: 10.1155/2016/1284372
    Pubmed KoreaMed CrossRef
  18. Kang Y, Massagué J (2004) Epithelial-mesenchymal transitions: twist in development and metastasis. Cell 118:277-279. doi: 10.1016/j.cell.2004.07.011
    Pubmed CrossRef
  19. Karthika C, Sureshkumar R, Zehravi M, Akter R, Ali F, Ramproshad S, Mondal B, Tagde P, Ahmed Z, Khan FS, Rahman MH, Cavalu S (2022) Multidrug resistance of cancer cells and the vital role of P-glycoprotein. Life (Basel) 12:897. doi: 10.3390/life12060897
    Pubmed KoreaMed CrossRef
  20. Kim RB (2002) Drugs as P-glycoprotein substrates, inhibitors, and inducers. Drug Metab Rev 34:47-54. doi: 10.1081/dmr-120001389
    Pubmed CrossRef
  21. Lamouille S, Xu J, Derynck R (2014) Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 15:178-196. doi: 10.1038/nrm3758
    Pubmed KoreaMed CrossRef
  22. Larue L, Bellacosa A (2005) Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3' kinase/AKT pathways. Oncogene 24:7443-7454. doi: 10.1038/sj.onc.1209091
    Pubmed CrossRef
  23. Li W, Zhang H, Assaraf YG, Zhao K, Xu X, Xie J, Yang DH, Chen ZS (2016) Overcoming ABC transporter-mediated multidrug resistance: molecular mechanisms and novel therapeutic drug strategies. Drug Resist Updat 27:14-29. doi: 10.1016/j.drup.2016.05.001
    Pubmed CrossRef
  24. Li Y, VandenBoom TG 2nd, Kong D, Wang Z, Ali S, Philip PA, Sarkar FH (2009) Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res 69:6704-6712. doi: 10.1158/0008-5472.CAN-09-1298
    Pubmed KoreaMed CrossRef
  25. Liedtke C, Mazouni C, Hess KR, André F, Tordai A, Mejia JA, Symmans WF, Gonzalez-Angulo AM, Hennessy B, Green M, Cristofanilli M, Hortobagyi GN, Pusztai L (2008) Response to neoadjuvant therapy and long-term survival in patients with triple-negative breast cancer. J Clin Oncol 26:1275-1281. doi: 10.1200/JCO.2007.14.4147
    Pubmed CrossRef
  26. Liu H, Liu Y, Zhang JT (2008) A new mechanism of drug resistance in breast cancer cells: fatty acid synthase overexpression-mediated palmitate overproduction. Mol Cancer Ther 7:263-270. doi: 10.1158/1535-7163.MCT-07-0445
    Pubmed CrossRef
  27. Liu J, Hu G, Chen D, Gong AY, Soori GS, Dobleman TJ, Chen XM (2013) Suppression of SCARA5 by Snail1 is essential for EMT-associated cell migration of A549 cells. Oncogenesis 2:e73. doi: 10.1038/oncsis.2013.37
    Pubmed KoreaMed CrossRef
  28. Moitra K (2015) Overcoming multidrug resistance in cancer stem cells. Biomed Res Int 2015:635745. doi: 10.1155/2015/635745
    Pubmed KoreaMed CrossRef
  29. Moreno-Bueno G, Portillo F, Cano A (2008) Transcriptional regulation of cell polarity in EMT and cancer. Oncogene 27:6958-6969. doi: 10.1038/onc.2008.346
    Pubmed CrossRef
  30. Naumov GN, Townson JL, MacDonald IC, Wilson SM, Bramwell VH, Groom AC, Chambers AF (2003) Ineffectiveness of doxorubicin treatment on solitary dormant mammary carcinoma cells or late-developing metastases. Breast Cancer Res Treat 82:199-206. doi: 10.1023/B:BREA.0000004377.12288.3c
    Pubmed CrossRef
  31. Nieto MA, Huang RY, Jackson RA, Thiery JP (2016) EMT: 2016. Cell 166:21-45. doi: 10.1016/j.cell.2016.06.028
    Pubmed CrossRef
  32. Osman AM, Bayoumi HM, Al-Harthi SE, Damanhouri ZA, Elshal MF (2012) Modulation of doxorubicin cytotoxicity by resveratrol in a human breast cancer cell line. Cancer Cell Int 12:47. doi: 10.1186/1475-2867-12-47
    Pubmed KoreaMed CrossRef
  33. Peinado H, Ballestar E, Esteller M, Cano A (2004) Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 24:306-319. doi: 10.1128/MCB.24.1.306-319.2004
    Pubmed KoreaMed CrossRef
  34. Pote MS, Gacche RN (2023) ATP-binding cassette efflux transporters and MDR in cancer. Drug Discov Today. doi: 10.1016/j.drudis.2023.103537
    Pubmed CrossRef
  35. Prihantono, Faruk M (2021) Breast cancer resistance to chemotherapy: when should we suspect it and how can we prevent it? Ann Med Surg (Lond) 70:102793. doi: 10.1016/j.amsu.2021.102793
    Pubmed KoreaMed CrossRef
  36. Puisieux A, Brabletz T, Caramel J (2014) Oncogenic roles of EMT-inducing transcription factors. Nat Cell Biol 16:488-494. doi: 10.1038/ncb2976
    Pubmed CrossRef
  37. Reed K, Poulin ML, Yan L, Parissenti AM (2010) Comparison of bisulfite sequencing PCR with pyrosequencing for measuring differences in DNA methylation. Anal Biochem 397:96-106. doi: 10.1016/j.ab.2009.10.021
    Pubmed CrossRef
  38. Rivera E, Gomez H (2010) Chemotherapy resistance in metastatic breast cancer: the evolving role of ixabepilone. Breast Cancer Res 12(Suppl 2):S2. doi: 10.1186/bcr2573
    Pubmed KoreaMed CrossRef
  39. Robichaud N, del Rincon SV, Huor B, Alain T, Petruccelli LA, Hearnden J, Goncalves C, Grotegut S, Spruck CH, Furic L, Larsson O, Muller WJ, Miller WH, Sonenberg N (2015) Phosphorylation of eIF4E promotes EMT and metastasis via translational control of SNAIL and MMP-3. Oncogene 34:2032-2042. doi: 10.1038/onc.2014.146
    Pubmed KoreaMed CrossRef
  40. Sabbah M, Emami S, Redeuilh G, Julien S, Prévost G, Zimber A, Ouelaa R, Bracke M, De Wever O, Gespach C (2008) Molecular signature and therapeutic perspective of the epithelial-to-mesenchymal transitions in epithelial cancers. Drug Resist Updat 11:123-151. doi: 10.1016/j.drup.2008.07.001
    Pubmed CrossRef
  41. Shen CJ, Kuo YL, Chen CC, Chen MJ, Cheng YM (2017) MMP1 expression is activated by Slug and enhances multi-drug resistance (MDR) in breast cancer. PLoS One 12:e0174487. doi: 10.1371/journal.pone.0174487
    Pubmed KoreaMed CrossRef
  42. Shi XP, Miao S, Wu Y, Zhang W, Zhang XF, Ma HZ, Xin HL, Feng J, Wen AD, Li Y (2013) Resveratrol sensitizes tamoxifen in antiestrogen-resistant breast cancer cells with epithelial-mesenchymal transition features. Int J Mol Sci 14:15655-15668. doi: 10.3390/ijms140815655
    Pubmed KoreaMed CrossRef
  43. Sun Q, Lesperance J, Wettersten H, Luterstein E, DeRose YS, Welm A, Cheresh DA, Desgrosellier JS (2018) Proapoptotic PUMA targets stem-like breast cancer cells to suppress metastasis. J Clin Invest 128:531-544. doi: 10.1172/JCI93707
    Pubmed KoreaMed CrossRef
  44. Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM (2006) Targeting multidrug resistance in cancer. Nat Rev Drug Discov 5:219-234. doi: 10.1038/nrd1984
    Pubmed CrossRef
  45. Tan TZ, Miow QH, Miki Y, Noda T, Mori S, Huang RY, Thiery JP (2014) Epithelial-mesenchymal transition spectrum quantification and its efficacy in deciphering survival and drug responses of cancer patients. EMBO Mol Med 6:1279-1293. doi: 10.15252/emmm.201404208
    Pubmed KoreaMed CrossRef
  46. Thiery JP, Sleeman JP (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol 7:131-142. doi: 10.1038/nrm1835
    Pubmed CrossRef
  47. Tsou SH, Chen TM, Hsiao HT, Chen YH (2015) A critical dose of doxorubicin is required to alter the gene expression profiles in MCF-7 cells acquiring multidrug resistance. PLoS One 10:e0116747. doi: 10.1371/journal.pone.0116747
    Pubmed KoreaMed CrossRef
  48. Wang Y, Chen Q, Jin S, Deng W, Li S, Tong Q, Chen Y (2012) Up-regulation of P-glycoprotein is involved in the increased paclitaxel resistance in human esophageal cancer radioresistant cells. Scand J Gastroenterol 47:802-808. doi: 10.3109/00365521.2012.683042
    Pubmed CrossRef
  49. Wiles ET, Bell R, Thomas D, Beckerle M, Lessnick SL (2013) ZEB2 represses the epithelial phenotype and facilitates metastasis in Ewing sarcoma. Genes Cancer 4:486-500. doi: 10.1177/1947601913506115
    Pubmed KoreaMed CrossRef
  50. Yauch RL, Januario T, Eberhard DA, Cavet G, Zhu W, Fu L, Pham TQ, Soriano R, Stinson J, Seshagiri S, Modrusan Z, Lin CY, O'Neill V, Amler LC (2005) Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res 11(24 Pt 1):8686-8698. doi: 10.1158/1078-0432.CCR-05-1492
    Pubmed CrossRef
  51. Yu Y, Xiao CH, Tan LD, Wang QS, Li XQ, Feng YM (2014) Cancer-associated fibroblasts induce epithelial-mesenchymal transition of breast cancer cells through paracrine TGF-β signalling. Br J Cancer 110:724-732. doi: 10.1038/bjc.2013.768
    Pubmed KoreaMed CrossRef
  52. Zhang F, Zhang H, Wang Z, Yu M, Tian R, Ji W, Yang Y, Niu R (2014) P-glycoprotein associates with Anxa2 and promotes invasion in multidrug resistant breast cancer cells. Biochem Pharmacol 87:292-302. doi: 10.1016/j.bcp.2013.11.003
    Pubmed CrossRef
  53. Zhang HC, Zhang F, Wu B, Han JH, Ji W, Zhou Y, Niu RF (2012) Identification of the interaction between P-Glycoprotein and Anxa2 in multidrug-resistant human breast cancer cells. Cancer Biol Med 9:99-104. doi: 10.3969/j.issn.2095-3941.2012.02.003
  54. Zhang T, Guo L, Creighton CJ, Lu Q, Gibbons DL, Yi ES, Deng B, Molina JR, Sun Z, Yang P, Yang Y (2016) A genetic cell context-dependent role for ZEB1 in lung cancer. Nat Commun 7:12231. doi: 10.1038/ncomms12231
    Pubmed KoreaMed CrossRef
  55. Zheng H, Kang Y (2014) Multilayer control of the EMT master regulators. Oncogene 33:1755-1763. doi: 10.1038/onc.2013.128
    Pubmed CrossRef
  56. Zhou L, Wang D, Sheng D, Xu J, Chen W, Qin Y, Du R, Yang X, He X, Xie N, Liu S, Zhang L (2020) NOTCH4 maintains quiescent mesenchymal-like breast cancer stem cells via transcriptionally activating SLUG and GAS1 in triple-negative breast cancer. Theranostics 10:2405-2421. doi: 10.7150/thno.38875
    Pubmed KoreaMed CrossRef
  57. Zhu K, Chen L, Han X, Wang J, Wang J (2012) Short hairpin RNA targeting Twist1 suppresses cell proliferation and improves chemosensitivity to cisplatin in HeLa human cervical cancer cells. Oncol Rep 27:1027-1034. doi: 10.3892/or.2012.1633
    Pubmed KoreaMed CrossRef